View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19551_low_10 (Length: 291)
Name: NF19551_low_10
Description: NF19551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19551_low_10 |
 |  |
|
| [»] chr3 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 254; Significance: 1e-141; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 18 - 291
Target Start/End: Complemental strand, 29321714 - 29321441
Alignment:
| Q |
18 |
aatcggattaaacgtttatgggatttagctaagctggatgatggaaatatctttaaagggaaacttggtgaagtgttttggtgcatgattcgagtaacgg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
29321714 |
aatcggattaaacgtttatgggatttagctaagctggatgatggaaatatctttaaggggaaacttggtgaagtgttttggtgcatgattcgagtaacag |
29321615 |
T |
 |
| Q |
118 |
aggtagaagatgtgagcgaagaacttaaattttatgcggtttgtgtgatcaaagatgttggttcagagaacttgaaggagatgggaagttggataaaaaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
29321614 |
aggtagaagatgtgagcgaagaacttaaattttatgcggtttgtgtgatcaaagatgttggttcagcgaacttgaaggagatgggaagtttgataaaaaa |
29321515 |
T |
 |
| Q |
218 |
tctttctcatgaggaagtgagaagggtagtgacggttgctgtgaacatgttgtcgtgtgttattgatgatcctc |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29321514 |
tctttctcatgaggaagtgagaagggtagttacggttgctgtgaacatgttgtcgtgtgttattgatgatcctc |
29321441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 22 - 136
Target Start/End: Complemental strand, 29304524 - 29304410
Alignment:
| Q |
22 |
ggattaaacgtttatgggatttagctaagctggatgatggaaatatctttaaagggaaacttggtgaagtgttttggtgcatgattcgagtaacggaggt |
121 |
Q |
| |
|
||||||| ||||| ||||| |||| ||| |||||||||||| |||||| | ||||||| ||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
29304524 |
ggattaatcgtttgtgggaattagttaaattggatgatggaagtatcttcatggggaaacatggtgaagtgttttggtgcatgattcgagtagcggaggt |
29304425 |
T |
 |
| Q |
122 |
agaagatgtgagcga |
136 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
29304424 |
agaagatgtgagcga |
29304410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 216 - 291
Target Start/End: Complemental strand, 29332707 - 29332632
Alignment:
| Q |
216 |
aatctttctcatgaggaagtgagaagggtagtgacggttgctgtgaacatgttgtcgtgtgttattgatgatcctc |
291 |
Q |
| |
|
|||||||||| |||||||||| |||||| | |||||||| |||| ||| | |||||||||||||||||||||| |
|
|
| T |
29332707 |
aatctttctctggaggaagtgaagagggtatttgcggttgctatgaagatgctatcgtgtgttattgatgatcctc |
29332632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University