View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19551_low_14 (Length: 248)
Name: NF19551_low_14
Description: NF19551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19551_low_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 13 - 233
Target Start/End: Original strand, 40368433 - 40368653
Alignment:
| Q |
13 |
aatattggtgtggtacaaataagccacttggatctcttaagtttgtgaagcatcatgtgatcaggttttttatctgaattatgtatatcaaaattcaccg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40368433 |
aatattggtgtggtacaaataagccacttggatctcttaagtttgtgaagcatcatgtgatcaggttttttatctgaattatgtatatcaaaattcaccg |
40368532 |
T |
|
| Q |
113 |
gttttgaagagtcgatcatttaaaactttgaagaatttagtctcagcaattgtgcgcgaaaaatgagatacaatccaaaattttatggtctctttctaaa |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40368533 |
gttttgaagagtcgatcatttaaaactttgaagaatttagtctcagcaattgtgcacgaaaaatgagatacaatccaaaattttatggtctctttctaaa |
40368632 |
T |
|
| Q |
213 |
aatatcttcatatgttgataa |
233 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
40368633 |
aatatcttcatatgttgataa |
40368653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University