View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19553_high_4 (Length: 264)

Name: NF19553_high_4
Description: NF19553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19553_high_4
NF19553_high_4
[»] chr1 (1 HSPs)
chr1 (14-245)||(42615158-42615389)


Alignment Details
Target: chr1 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 14 - 245
Target Start/End: Complemental strand, 42615389 - 42615158
Alignment:
14 aatatatataatcaaccttaatcaacctcaatttcttcatcatggagttttcaaatggagataatagcaatggtagtaacggttcttccatgaatctttg 113  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
42615389 aatatatataattaaccttaatcaacctcaatttcttcatcatggagttttcaaatggagataatagcaatggtagtaacggttcttccatgaatcttcg 42615290  T
114 caatggtggaacaaaaactagtaacaacaatgaccctttgaattggggtatagctgcagattctatgaagggtagtcacctagatgaggtgaagcgtatg 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42615289 caatggtggaacaaaaactagtaacaacaatgaccctttgaattggggtatagctgcagattctatgaagggtagtcacctagatgaggtgaagcgtatg 42615190  T
214 gtagaggaataccggaaaccggttgtgccctt 245  Q
    ||||||||||||||||||||||||||||||||    
42615189 gtagaggaataccggaaaccggttgtgccctt 42615158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University