View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19554_high_11 (Length: 222)
Name: NF19554_high_11
Description: NF19554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19554_high_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 5 - 203
Target Start/End: Original strand, 38532072 - 38532270
Alignment:
| Q |
5 |
gtgggtagattattctttgcttttgattatataaaaaagtaaaatgatgaaaatttgcttgtcacatatggtaaaatggctagattattatttgcttctg |
104 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38532072 |
gtggctagattattatttgcttttgattatataaaaaagtaaaatgatgaaaatttgcttgtcacatatggtaaaatggctagattattatttgcttctg |
38532171 |
T |
 |
| Q |
105 |
cttttatatgcaaaaaagttatttgcttctgcttttatatacaaaaaagtaaagttgcaacatgtaaatatgtataacctctctaatcttcacaacggt |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
38532172 |
cttttatatgcaaaaaagttatttgcttctgcttttatatacaaaaaagtaaagttgcaacatgtaaatatgtataacctctcgaatcttcacaacggt |
38532270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 47 - 101
Target Start/End: Original strand, 38532039 - 38532093
Alignment:
| Q |
47 |
aatgatgaaaatttgcttgtcacatatggtaaaatggctagattattatttgctt |
101 |
Q |
| |
|
|||||||||||| ||||||||| | ||| ||| ||||||||||||||||||||| |
|
|
| T |
38532039 |
aatgatgaaaatatgcttgtcataattggcaaagtggctagattattatttgctt |
38532093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University