View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19554_low_10 (Length: 240)
Name: NF19554_low_10
Description: NF19554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19554_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 19 - 226
Target Start/End: Original strand, 10609908 - 10610115
Alignment:
| Q |
19 |
atatctgaattgaatacatgtgtctcacactcaactatgtccactgtattatttgggaactcannnnnnngggaggatatttgggaactcattattatct |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
10609908 |
atatctgaattgaatacatgtgtctcacactcaactatgtccactgtattatttgggaactcatttttttgggaggatatttgggaactcattattatct |
10610007 |
T |
|
| Q |
119 |
actataagtgggatatttcaacatctaatttaataattaggagatggcaaatattattagtttgattttgatatttaatttcagatattttgttgaggct |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10610008 |
actataagtgggatatttcaacatctaatttaataattaggagatggcaaatattattattttgattttgatatttaatttcagatattttgttgaggct |
10610107 |
T |
|
| Q |
219 |
agtataat |
226 |
Q |
| |
|
|||||||| |
|
|
| T |
10610108 |
agtataat |
10610115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University