View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19554_low_9 (Length: 281)

Name: NF19554_low_9
Description: NF19554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19554_low_9
NF19554_low_9
[»] chr8 (1 HSPs)
chr8 (1-249)||(39209926-39210174)


Alignment Details
Target: chr8 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 249
Target Start/End: Complemental strand, 39210174 - 39209926
Alignment:
1 gtttgttttattattagtggctccaatgtgcatgttggttatgcaccactgttttattcgagtcactctttatgattggcgctacaaattgctggctaga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39210174 gtttgttttattattagtggctccaatgtgcatgttggttatgcaccactgttttattcgagtcactctttatgattggcgctacaaattgctggctaga 39210075  T
101 aatgaccgtaaaggtttttgatttgatgcactgagttgtaggatgtggatcagtattcgtgttggtggtctggtccattactcacccttaaagatctaga 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||    
39210074 aatgaccgtaaaggtttttgatttgatgcactgagttgtaggatgtggatcagtattcgtgttggtggtctggtccattattcatccttaaagatctaga 39209975  T
201 ttatatgttgtaaacattcacccatttcttttttgcaatttggcttcaa 249  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
39209974 ttatatgttgtaaacattcacccatttcttttttgcaatttggcttcaa 39209926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University