View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19555_high_11 (Length: 509)
Name: NF19555_high_11
Description: NF19555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19555_high_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 306; Significance: 1e-172; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 77 - 491
Target Start/End: Complemental strand, 9575077 - 9574661
Alignment:
| Q |
77 |
ccacaatgggattctctcaaattattttgaccactctttatttatttatcaacatggcaatgacatcgtctatattcttttgtatgtggatgccattatt |
176 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||| ||| |
|
|
| T |
9575077 |
ccacaatgggattctcttaaattattttgaccactctttatttatttatcaacatggcaatgacaccgtctatattcttttgtatgtggatgacatcatt |
9574978 |
T |
 |
| Q |
177 |
cttgccgcttcttctgactctctttatgaattgattatgtctaagcttaactttgaatttttcgtgaagtcatca--cccgtccagttatttttctttct |
274 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| | ||||| | | ||||||||||||||||||||||| |
|
|
| T |
9574977 |
cttgccgcttcttctgactatctttatgaattgattatgtctaagcttaactttgaattttccatgaaggattgaggcccgtccagttatttttctttct |
9574878 |
T |
 |
| Q |
275 |
caaaataaatatgcagaggaagttattgagcacacatgtatgtctgctggcaagtcatcacccacacatgtgaatacaaaggcaaaactcagtggttctt |
374 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
9574877 |
caaaataaatatgcagaggaagttattgagcacacatgtatgtctactggcaagtcatcacccatacatgtgaatacaaaggcaaaactcagtggttctt |
9574778 |
T |
 |
| Q |
375 |
caagaaactcctatgaagatccaacataatatcataacctcgcttgatctttgcaatacctgacatttacaagatcaaatatctcttctgaagcacaaga |
474 |
Q |
| |
|
|| ||||| ||||||||||||||||||||||||||| |||||||||| | ||| | ||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
9574777 |
catgaaacccctatgaagatccaacataatatcatagcctcgcttgagcattgtagtacctgacatttacaagatcaaatatctcttatgaagttcaaga |
9574678 |
T |
 |
| Q |
475 |
catgtgcttgtttatac |
491 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
9574677 |
agtgtgcttgtttatac |
9574661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 13 - 80
Target Start/End: Complemental strand, 9575176 - 9575109
Alignment:
| Q |
13 |
atactcaactccctggccatgtctgtcttctaaaaaattctctccatggacttatacaagcaccccac |
80 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9575176 |
atactcaactccctggccatgtatgtcttctaaaaaattctctccatggacttatacaagcaccccac |
9575109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University