View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19555_high_50 (Length: 286)
Name: NF19555_high_50
Description: NF19555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19555_high_50 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 1 - 277
Target Start/End: Original strand, 16511274 - 16511550
Alignment:
| Q |
1 |
tgagccacttccagcaacaactgaggatgaacaagcactttcggagtcagctttgaacaaacttgttggagctgcagaagtctttgacctggaggtatat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16511274 |
tgagccacttccagcaacaactgaggatgaacaagcactttcggagtcagctttgaacaaacttgttggagctgcagaagtctttgacctggaggtatat |
16511373 |
T |
|
| Q |
101 |
aaaatgtgttccaatttcaattgtttggctgcgacttctctattgcgtaactgacctttttatgtctttcacatctttaggagaaggaagccccaaagac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16511374 |
aaaatgtgttccaatttcaattgtttggctgcgacttctctattgtgtaactgacctttttatgtctttcacatctttaggagaaggaagccccaaagac |
16511473 |
T |
|
| Q |
201 |
actgatgtgtagtctaaagccttaccagagtcaagctctgtattggatgacaaaaattgagaagggaggtgatgatg |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16511474 |
actgatgtgtagtctaaagccttaccagagtcaagctctgtattggatgacaaaaattgagaagggaggtgatgatg |
16511550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University