View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19555_high_51 (Length: 284)
Name: NF19555_high_51
Description: NF19555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19555_high_51 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 78 - 284
Target Start/End: Complemental strand, 44685281 - 44685075
Alignment:
| Q |
78 |
aacatgcatgataaatcaaataacatgatgcaagcttctacaaattgagtcaattgtgtctattgttctgtaaggatcatgaacaatcaaaattaaccca |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44685281 |
aacatgcatgataaatcaaataacatgatgcaagcttctacaaattgagtcaattgtgtctattgttctgtaaggatcatgaacaatcaaaattaaccca |
44685182 |
T |
 |
| Q |
178 |
agcttctacaataacctcttctagccacactagaagctaccaaactaggcttatagtaatatgtttgtccctgagaagataactctgagatgagtgctgc |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
44685181 |
agcttctacaataacctcttctagccacactagaagctaccaaactaggcttatagtaatatgtttgtccctgagaagataactctgagatgagtgctac |
44685082 |
T |
 |
| Q |
278 |
attgtac |
284 |
Q |
| |
|
||||||| |
|
|
| T |
44685081 |
attgtac |
44685075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 14 - 98
Target Start/End: Complemental strand, 44685417 - 44685333
Alignment:
| Q |
14 |
ttctaacactgattacaaaaataaacaattttctatcaccatcgtggacaaagttgctaaggtgaacatgcatgataaatcaaat |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44685417 |
ttctaacactgattacaaaaataaacaattttctatcaccatcgtggacaaagttgctaaggtgaacatgcatgataaatcaaat |
44685333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University