View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19555_high_53 (Length: 283)
Name: NF19555_high_53
Description: NF19555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19555_high_53 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 167; Significance: 2e-89; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 1 - 188
Target Start/End: Complemental strand, 38327279 - 38327090
Alignment:
| Q |
1 |
tatttgtaaatttgagcagaattggacatgtctatagtggataaagagaagaccaatttataagttgctctatttaatgtgagatgcttatcaaatacca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38327279 |
tatttgtaaatttgagcagaattggacatgtctatagtggataaagagaagaccaatttataagttgctctatttaatgtgagatgcttatcaaatacca |
38327180 |
T |
|
| Q |
101 |
atatt--ttttagtagatagacgaaatgacaaatatatattagaactcacatacaattggaggggccggagttcgaacctctgttaaggt |
188 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38327179 |
atattttttttagtagatagacgaaatgacaaataactattagaactcacatacaattggaggggcaggagttcgaacctctgttaaggt |
38327090 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 219 - 267
Target Start/End: Complemental strand, 38327086 - 38327038
Alignment:
| Q |
219 |
ggttgagttaggaattgtggactatcaaatttcaatactatgagattga |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38327086 |
ggttgagttaggaattgtggactatcaaatttcaatactatgagattga |
38327038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 104 - 159
Target Start/End: Original strand, 30241416 - 30241471
Alignment:
| Q |
104 |
ttttttagtagatagacgaaatgacaaatatatattagaactcacatacaattgga |
159 |
Q |
| |
|
|||||| ||||||||||||||||| ||||| | |||| ||||||||||||| |||| |
|
|
| T |
30241416 |
ttttttggtagatagacgaaatgaaaaataaacattaaaactcacatacaagtgga |
30241471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 196 - 240
Target Start/End: Complemental strand, 28401132 - 28401088
Alignment:
| Q |
196 |
ttaacaatttctacatttttatgggttgagttaggaattgtggac |
240 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||| | |||||||| |
|
|
| T |
28401132 |
ttaacaatttcaacatttttatggggtgagttagaagttgtggac |
28401088 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University