View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19555_high_58 (Length: 266)
Name: NF19555_high_58
Description: NF19555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19555_high_58 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 23 - 247
Target Start/End: Original strand, 43935045 - 43935269
Alignment:
| Q |
23 |
ctctatgacttcttagagcattttcttagaacgtcttcgacctttgtggactttgttcggtactttgaagttggtaactcaaagaccaagtgatggaatc |
122 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43935045 |
ctctatgacttcttagagcatcttcttagaacgtcttcgacctttgtggactttgttcggtactttgaagttggtaactcaaagaccaagtgatggaatc |
43935144 |
T |
 |
| Q |
123 |
caggacggccgaccagaggaatttaagactaggttaagagatctcagggcgcccaagcagggaaccttgaaccattgaaggcgagcacggtggtgacaga |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
43935145 |
caggacggccgaccagaggaatttaagactaggttaagagatctcagggcgcccaaccagggaaccttgaatcattgaaggcgagcacggtggtgacaga |
43935244 |
T |
 |
| Q |
223 |
tgatcagggtgccgaagtgtcatga |
247 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
43935245 |
tgatcagggtgccgaagtgtcatga |
43935269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University