View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19555_high_65 (Length: 246)
Name: NF19555_high_65
Description: NF19555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19555_high_65 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 54; Significance: 4e-22; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 168 - 233
Target Start/End: Original strand, 5400292 - 5400357
Alignment:
| Q |
168 |
gtttctaaggacttaaaattgatttagtatgtttggaacttttcaattacaattaattttgtcttt |
233 |
Q |
| |
|
|||||||| | |||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
5400292 |
gtttctaaaggcttaaaattgatttagtatgtttggagcttttcaattacaattaattttgtcttt |
5400357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 100 - 163
Target Start/End: Original strand, 5400255 - 5400318
Alignment:
| Q |
100 |
atacatgtttagattcactttttggagagttaaaggtgtttctaaagacttaaaattgatttag |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| |||||||||||| |||||||||||||||| |
|
|
| T |
5400255 |
atacatgtttagattcactttttggagagtcaaaagtgtttctaaaggcttaaaattgatttag |
5400318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University