View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19555_low_35 (Length: 375)
Name: NF19555_low_35
Description: NF19555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19555_low_35 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 83 - 358
Target Start/End: Original strand, 31478969 - 31479244
Alignment:
| Q |
83 |
taacttccagcgtatgatcccccaaccacaatcaccggggacttttgtgcatgtagtgaatccttcaaatatagcagaacttctgcgtaatcagcaaggg |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31478969 |
taacttccagcgtatgatcccccaaccacaatcaccggggacttttgtgcatgtagtgaatccttcaaatatagcagaacttctgcgtaatcagcaaggg |
31479068 |
T |
 |
| Q |
183 |
cttgtgctgagtttaaatagccgtaagatgcgttaaagctgggcactgacttcccgtagtaccggtgctaacaagaaaattaaaagtggtatcagaatcg |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
31479069 |
cttgtgctgagtttaaatagccgtaagatgcgttaaagctgggcactgacttcccgtagtaccggtgctaacaagaaaattaaaagttgtatcagaatcg |
31479168 |
T |
 |
| Q |
283 |
taaaactaatttgatttagatcaatgagtgtcaaaagaaatagtcttctatttagtacctcaatgtatactagtag |
358 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
31479169 |
taaaactaatttgattttgatcaatgagtgtcaaaagaaatagttttctatttagtacctcaatgtatactagtag |
31479244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University