View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19555_low_39 (Length: 339)
Name: NF19555_low_39
Description: NF19555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19555_low_39 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 23 - 322
Target Start/End: Original strand, 55015156 - 55015451
Alignment:
| Q |
23 |
tgcactactgtaatgnnnnnnnctttcttgaatttaacaagaatagagtgagtgtgtcattgtggttgtttgttaattgtcttcaagttagccacgaagc |
122 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55015156 |
tgcactactgtaatgtttttttctttcttgaatttaacaagaatagagtgagtgtgtcattgtggttgtttgttaattgtcttcaagttagccacgaagc |
55015255 |
T |
 |
| Q |
123 |
tttttgttttgattgtgcgttatactaacttctttttaacttattggcgtgaagttcttatattagtttgattgatcaaccttagtggagtctcccctta |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55015256 |
tttttgttttgattgtgcgttatactaacttctttttaacttattggtgtgaagttcttatattagtttgattgatcaaccttagtggagtctcccctta |
55015355 |
T |
 |
| Q |
223 |
cgaatggttaatactcaaataaataaataaacattaactaagacttgagatttaaactaaagttctaatcagaccaacctaaagttggtatatgcatatg |
322 |
Q |
| |
|
| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55015356 |
caaatggttaatactc----aaataaataaacattaactaagacttgagatttaaactaaagttctaatcagaccaacctaaagttggtatatgcatatg |
55015451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University