View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19555_low_63 (Length: 258)
Name: NF19555_low_63
Description: NF19555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19555_low_63 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 156; Significance: 6e-83; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 12 - 183
Target Start/End: Original strand, 32524753 - 32524924
Alignment:
| Q |
12 |
cataaaattcctatgataattgcgaaattgtttctttagtgtttcttcaaaaggatcttgattgtcaatatctttgtagatgactagtttgtgtttgtat |
111 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32524753 |
cataaaattcgtatgataattgcgaaattgtttctttagtgtttcttcaaaaggatcttgattgtcaatatctttgtagatgactagtttgtgtttgtat |
32524852 |
T |
|
| Q |
112 |
tggatggaatgtatgattttttcaatacaatatttgtttttgtcaccataataataataaaagaatcttctc |
183 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
32524853 |
tggatgaaatgtatgattttttcaatacaatatttgtttttgttaccataataataataaaagaattttctc |
32524924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 18 - 58
Target Start/End: Complemental strand, 32522736 - 32522696
Alignment:
| Q |
18 |
attcctatgataattgcgaaattgtttctttagtgtttctt |
58 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
32522736 |
attcctatgataattgcaaaactgtttctttagtgtttctt |
32522696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 128 - 168
Target Start/End: Complemental strand, 32526896 - 32526856
Alignment:
| Q |
128 |
ttttttcaatacaatatttgtttttgtcaccataataataa |
168 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
32526896 |
tttttttaatacaatatttgtttttgtcaccacaataataa |
32526856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 16 - 58
Target Start/End: Complemental strand, 32526964 - 32526922
Alignment:
| Q |
16 |
aaattcctatgataattgcgaaattgtttctttagtgtttctt |
58 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32526964 |
aaattactatgataattgcataattgtttctttagtgtttctt |
32526922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 128 - 168
Target Start/End: Complemental strand, 32522627 - 32522587
Alignment:
| Q |
128 |
ttttttcaatacaatatttgtttttgtcaccataataataa |
168 |
Q |
| |
|
||||||||||||||||||||||||| |||| | |||||||| |
|
|
| T |
32522627 |
ttttttcaatacaatatttgtttttctcacgacaataataa |
32522587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University