View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19555_low_71 (Length: 237)
Name: NF19555_low_71
Description: NF19555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19555_low_71 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 3 - 222
Target Start/End: Complemental strand, 38481978 - 38481759
Alignment:
| Q |
3 |
cgtgacttgttttcctccaattcacttgaaggattgattgtattgtggatgagttatcgacggtatgaggaaggaatgaaattgttgatatgagcaatca |
102 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
38481978 |
cgtgacttgttttcttccaattcacttgaaggattgattgtattgtggatgagttatcgatggtatgaggaaggaatggaattgttgatatgagcaatca |
38481879 |
T |
|
| Q |
103 |
agtgacaacttttcatcccacattcgggagaattggtggaaccgtgaggggaagtggttataaattgaaagtatatgatattatacaacgtgcatagttg |
202 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
38481878 |
agtgacaactattcatcccacatcggggagaattggtgaaaccgtgaggggaagtggttataaattgaaagtatatgatattatacaacgtgcatacttg |
38481779 |
T |
|
| Q |
203 |
gatggatttgtgtaaggagt |
222 |
Q |
| |
|
||||||||||||| |||||| |
|
|
| T |
38481778 |
gatggatttgtgtgaggagt |
38481759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University