View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19555_low_72 (Length: 237)
Name: NF19555_low_72
Description: NF19555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19555_low_72 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 2 - 221
Target Start/End: Original strand, 28319705 - 28319924
Alignment:
| Q |
2 |
ttcattgagcattaacaagtacgatgatttggttttccattcatatggtgtgaattaaattggacctattaattgatgttctagctacaactaaattgca |
101 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
28319705 |
ttcagtgagcattaacaagtacgatgatttggttttccattcatatggtgtgaattaaattggacctattaattgatgttctagctacaactaaattaca |
28319804 |
T |
 |
| Q |
102 |
acactaggatgattttcttcttaagaaaattcttggaaaaatgctccaacctttcttagttttagtcagcttcttaagctcatttctaatgcttgaacat |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28319805 |
acactaggatgattttcttcttaagaaaattcttggaaaaatgctccaacctttcttagttttagtcagcttcttaagctcatttctaatgcttgaacat |
28319904 |
T |
 |
| Q |
202 |
tccttctctagctctgatac |
221 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
28319905 |
tccttctctagctctgatac |
28319924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 134 - 209
Target Start/End: Complemental strand, 5951505 - 5951430
Alignment:
| Q |
134 |
ttggaaaaatgctccaacctttcttagttttagtcagcttcttaagctcatttctaatgcttgaacattccttctc |
209 |
Q |
| |
|
|||||||||||||||||| |||||| ||||| || ||||||| | ||| |||| ||||||||||||||| ||||| |
|
|
| T |
5951505 |
ttggaaaaatgctccaacttttctttgtttttgttagcttctgcaactcttttcgaatgcttgaacattctttctc |
5951430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University