View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19555_low_77 (Length: 215)
Name: NF19555_low_77
Description: NF19555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19555_low_77 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 56 - 197
Target Start/End: Complemental strand, 909825 - 909684
Alignment:
| Q |
56 |
ctatgtgtaagagcttgacagttgactctatggtgtagaaagacttattgctgcatgtttgttactgttaatcttcagtattataaactatattttgatc |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
909825 |
ctatgtgtaagagcttgacagttgactctatggtgtagaaagacttattgctgcatgtttgttactgttaatcttcagtattataaactatattttgatc |
909726 |
T |
|
| Q |
156 |
tgcatccaattattcttattttcttgaatcaatgtggatgat |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
909725 |
tgcatccaattattcttattttcttgaatcaatgtggatgat |
909684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University