View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19556_high_16 (Length: 362)

Name: NF19556_high_16
Description: NF19556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19556_high_16
NF19556_high_16
[»] chr2 (12 HSPs)
chr2 (18-349)||(1288824-1289156)
chr2 (286-349)||(14530391-14530453)
chr2 (288-330)||(19185763-19185805)
chr2 (288-349)||(9671252-9671312)
chr2 (288-349)||(10543773-10543833)
chr2 (288-349)||(10546236-10546296)
chr2 (289-349)||(40579751-40579810)
chr2 (288-347)||(24859992-24860050)
chr2 (288-349)||(8455318-8455378)
chr2 (288-349)||(14444801-14444861)
chr2 (288-349)||(36871565-36871624)
chr2 (288-349)||(40762236-40762296)
[»] chr6 (6 HSPs)
chr6 (286-349)||(12221916-12221979)
chr6 (287-349)||(6808467-6808528)
chr6 (286-349)||(29355857-29355919)
chr6 (288-349)||(13267798-13267858)
chr6 (288-349)||(1941928-1941988)
chr6 (290-330)||(11395836-11395876)
[»] chr1 (15 HSPs)
chr1 (288-349)||(18944741-18944802)
chr1 (288-330)||(4430019-4430061)
chr1 (288-349)||(27474376-27474436)
chr1 (288-349)||(4349734-4349794)
chr1 (288-349)||(41440604-41440664)
chr1 (288-349)||(42304209-42304269)
chr1 (286-349)||(10668321-10668383)
chr1 (288-330)||(11596608-11596650)
chr1 (288-349)||(35005221-35005281)
chr1 (288-349)||(35253189-35253249)
chr1 (288-349)||(46247955-46248015)
chr1 (288-349)||(50606499-50606559)
chr1 (288-328)||(27136673-27136713)
chr1 (288-348)||(45402192-45402251)
chr1 (288-348)||(46991900-46991959)
[»] chr5 (7 HSPs)
chr5 (286-349)||(25622531-25622593)
chr5 (286-349)||(38879654-38879716)
chr5 (288-349)||(16957387-16957447)
chr5 (299-349)||(32354211-32354260)
chr5 (288-333)||(22600527-22600572)
chr5 (288-349)||(24448963-24449023)
chr5 (288-349)||(41014391-41014451)
[»] chr3 (10 HSPs)
chr3 (286-349)||(46421036-46421099)
chr3 (286-349)||(13628792-13628854)
chr3 (286-351)||(8247686-8247751)
chr3 (288-349)||(24851303-24851363)
chr3 (288-349)||(25517172-25517232)
chr3 (288-349)||(40272814-40272874)
chr3 (288-349)||(54484786-54484846)
chr3 (297-349)||(10484618-10484669)
chr3 (288-329)||(10795444-10795485)
chr3 (286-350)||(353350-353413)
[»] chr8 (8 HSPs)
chr8 (288-349)||(35261752-35261812)
chr8 (288-341)||(44530222-44530274)
chr8 (286-341)||(20284079-20284133)
chr8 (286-341)||(21070707-21070761)
chr8 (286-349)||(39460996-39461058)
chr8 (288-349)||(12625963-12626023)
chr8 (288-349)||(28817628-28817688)
chr8 (288-349)||(35107313-35107373)
[»] chr7 (4 HSPs)
chr7 (286-349)||(43557545-43557608)
chr7 (290-349)||(45018925-45018983)
chr7 (288-349)||(7879711-7879771)
chr7 (288-349)||(11617590-11617650)
[»] chr4 (15 HSPs)
chr4 (286-349)||(38755910-38755972)
chr4 (288-349)||(20639660-20639720)
chr4 (288-349)||(44363132-44363192)
chr4 (286-349)||(16408603-16408665)
chr4 (286-349)||(23501860-23501922)
chr4 (286-349)||(33836489-33836551)
chr4 (286-341)||(50555666-50555720)
chr4 (286-349)||(54730323-54730385)
chr4 (291-349)||(36816386-36816443)
chr4 (316-349)||(2813228-2813261)
chr4 (288-349)||(11394925-11394985)
chr4 (288-349)||(11404652-11404712)
chr4 (288-349)||(40915901-40915961)
chr4 (289-349)||(32484307-32484366)
chr4 (297-349)||(40553939-40553990)
[»] scaffold0057 (1 HSPs)
scaffold0057 (288-349)||(46904-46964)
[»] scaffold0180 (1 HSPs)
scaffold0180 (288-349)||(24135-24195)


Alignment Details
Target: chr2 (Bit Score: 264; Significance: 1e-147; HSPs: 12)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 18 - 349
Target Start/End: Original strand, 1288824 - 1289156
Alignment:
18 ctaagtgagcgtgtattctttaaactttcatccaatataatttcaggttccattgtattacatgccacttgtgatatgtattgtaaatttaggaaatcat 117  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
1288824 ctaagtgagcgtgtattctttaaactttcatccagtataatttcaggttccattgtattacatgccacttgcgatatgtattgtaaatttaggaaatcat 1288923  T
118 gaactagaaggaaaataaagacttcaagtctaaaccttcccagcccagtaaatgtatcccaaataataatgcttgaaaaataattagttattcaatagta 217  Q
    |||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1288924 gaaccagaaggaaaataaagacttcaagtctaaaccatcccagcccagtaaatgtatcccaaataataatgcttgaaaaataattagttattcaatagta 1289023  T
218 atacattaagctagtttattgtatggaattgattaacatcattaagattggatatgagcaa-nnnnnnnataatggtggaaccccttcctggatcctgtg 316  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||        |||||||||| ||||||||| ||||| ||      
1289024 atacattaagctagtttattgcatggaattgattaacatcattaagattggatatgagcaattttttttataatggtgggaccccttcccggatcatgca 1289123  T
317 tatgcgggagcttttagtgcaccggattgccct 349  Q
    |||||||||||||||||||||||||||||||||    
1289124 tatgcgggagcttttagtgcaccggattgccct 1289156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 286 - 349
Target Start/End: Original strand, 14530391 - 14530453
Alignment:
286 ataatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct 349  Q
    |||||||||| ||||||||| ||| |||| |||||||||||| ||||||||||||| |||||||    
14530391 ataatggtgggaccccttcccggaccctgcgtatgcgggagc-tttagtgcaccgggttgccct 14530453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 288 - 330
Target Start/End: Complemental strand, 19185805 - 19185763
Alignment:
288 aatggtggaaccccttcctggatcctgtgtatgcgggagcttt 330  Q
    |||||||||||||||||||||| |||| |||||||||||||||    
19185805 aatggtggaaccccttcctggaccctgcgtatgcgggagcttt 19185763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 288 - 349
Target Start/End: Original strand, 9671252 - 9671312
Alignment:
288 aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct 349  Q
    |||||||| ||||||||| ||| |||| |||||||||||| ||||||||||||| |||||||    
9671252 aatggtgggaccccttcccggaccctgcgtatgcgggagc-tttagtgcaccgggttgccct 9671312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 288 - 349
Target Start/End: Original strand, 10543773 - 10543833
Alignment:
288 aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct 349  Q
    |||||||| ||||||||| ||| |||| |||||||||||| ||||||||||||| |||||||    
10543773 aatggtgggaccccttcccggaccctgcgtatgcgggagc-tttagtgcaccgggttgccct 10543833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 288 - 349
Target Start/End: Original strand, 10546236 - 10546296
Alignment:
288 aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct 349  Q
    |||||||| ||||||||| ||| |||| |||||||||||| ||||||||||||| |||||||    
10546236 aatggtgggaccccttcccggaccctgcgtatgcgggagc-tttagtgcaccgggttgccct 10546296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 289 - 349
Target Start/End: Complemental strand, 40579810 - 40579751
Alignment:
289 atggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct 349  Q
    ||||||| ||||||||| ||| |||| |||||||||||| ||||||||||||| |||||||    
40579810 atggtgggaccccttcccggaccctgagtatgcgggagc-tttagtgcaccgggttgccct 40579751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 288 - 347
Target Start/End: Complemental strand, 24860050 - 24859992
Alignment:
288 aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgcc 347  Q
    |||||| ||||||||||  ||| |||| |||||||||||| |||||||||||||||||||    
24860050 aatggtagaaccccttctcggaccctgcgtatgcgggagc-tttagtgcaccggattgcc 24859992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 288 - 349
Target Start/End: Complemental strand, 8455378 - 8455318
Alignment:
288 aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct 349  Q
    |||||||| ||||||||| ||| |||| |||||| |||||||| |||||||||| |||||||    
8455378 aatggtgggaccccttcccggaccctgcgtatgccggagcttt-agtgcaccgggttgccct 8455318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 288 - 349
Target Start/End: Original strand, 14444801 - 14444861
Alignment:
288 aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct 349  Q
    |||||||| ||||||||| ||| |||| |||||||||||| ||||||||||| | |||||||    
14444801 aatggtgggaccccttcccggaccctgcgtatgcgggagc-tttagtgcaccaggttgccct 14444861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 288 - 349
Target Start/End: Original strand, 36871565 - 36871624
Alignment:
288 aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct 349  Q
    |||||||| ||||||||| ||| |||| ||||||||||||||| |||||||||| |||||||    
36871565 aatggtgggaccccttcccgga-cctgcgtatgcgggagcttt-agtgcaccgggttgccct 36871624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 288 - 349
Target Start/End: Complemental strand, 40762296 - 40762236
Alignment:
288 aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct 349  Q
    |||||||| |||| |||||||| |||| ||||| ||||||||| |||||||||| |||||||    
40762296 aatggtgggaccctttcctggaccctgcgtatgtgggagcttt-agtgcaccgggttgccct 40762236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 44; Significance: 6e-16; HSPs: 6)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 286 - 349
Target Start/End: Complemental strand, 12221979 - 12221916
Alignment:
286 ataatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct 349  Q
    |||||||||| ||||||||| ||| |||| |||||||||||||||||||||||||| |||||||    
12221979 ataatggtgggaccccttcccggaccctgcgtatgcgggagcttttagtgcaccgggttgccct 12221916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 287 - 349
Target Start/End: Original strand, 6808467 - 6808528
Alignment:
287 taatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct 349  Q
    ||||||||| ||||||||| ||| ||||||||||||||||| ||||||||||||| |||||||    
6808467 taatggtgggaccccttcccggaccctgtgtatgcgggagc-tttagtgcaccgggttgccct 6808528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 286 - 349
Target Start/End: Complemental strand, 29355919 - 29355857
Alignment:
286 ataatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct 349  Q
    |||||||||| ||||||||| ||| |||| |||||||||||| ||||||||||||| |||||||    
29355919 ataatggtgggaccccttcccggaccctgcgtatgcgggagc-tttagtgcaccgggttgccct 29355857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 288 - 349
Target Start/End: Original strand, 13267798 - 13267858
Alignment:
288 aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct 349  Q
    |||||||| ||||||||||||| |||| |||||||||||| || |||||||||| |||||||    
13267798 aatggtgggaccccttcctggaccctgcgtatgcgggagc-ttcagtgcaccgggttgccct 13267858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 288 - 349
Target Start/End: Original strand, 1941928 - 1941988
Alignment:
288 aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct 349  Q
    |||||||| ||||| ||||||||| |||||||||||||| |||| ||||||||  |||||||    
1941928 aatggtgggaccccatcctggatcttgtgtatgcgggag-tttttgtgcaccgtgttgccct 1941988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 290 - 330
Target Start/End: Original strand, 11395836 - 11395876
Alignment:
290 tggtggaaccccttcctggatcctgtgtatgcgggagcttt 330  Q
    |||||| ||||||||| |||||||| |||||||||||||||    
11395836 tggtgggaccccttcccggatcctgcgtatgcgggagcttt 11395876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 42; Significance: 0.000000000000009; HSPs: 15)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 288 - 349
Target Start/End: Original strand, 18944741 - 18944802
Alignment:
288 aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct 349  Q
    |||||||| ||||||||| ||| |||| |||||||||||||||||||||||||| |||||||    
18944741 aatggtgggaccccttcccggaccctgcgtatgcgggagcttttagtgcaccgggttgccct 18944802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 288 - 330
Target Start/End: Complemental strand, 4430061 - 4430019
Alignment:
288 aatggtggaaccccttcctggatcctgtgtatgcgggagcttt 330  Q
    |||||||||||||||| ||||||||||||||||||||||||||    
4430061 aatggtggaacccctttctggatcctgtgtatgcgggagcttt 4430019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 288 - 349
Target Start/End: Original strand, 27474376 - 27474436
Alignment:
288 aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct 349  Q
    |||||||| ||||||||| ||| |||| |||||||||||| |||||||||||||||||||||    
27474376 aatggtgggaccccttcccggaccctgcgtatgcgggagc-tttagtgcaccggattgccct 27474436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 288 - 349
Target Start/End: Original strand, 4349734 - 4349794
Alignment:
288 aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct 349  Q
    |||||||| ||||||||| ||| |||| |||||||||||| ||||||||||||| |||||||    
4349734 aatggtgggaccccttcccggaccctgcgtatgcgggagc-tttagtgcaccgggttgccct 4349794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 288 - 349
Target Start/End: Complemental strand, 41440664 - 41440604
Alignment:
288 aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct 349  Q
    ||||||||||||||||||| ||  |||||||||||||||| ||||||| |||||| ||||||    
41440664 aatggtggaaccccttcctagactctgtgtatgcgggagc-tttagtgaaccggactgccct 41440604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 288 - 349
Target Start/End: Complemental strand, 42304269 - 42304209
Alignment:
288 aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct 349  Q
    |||||||| ||||||||| ||| |||| ||||| ||||||||| ||||||||||||||||||    
42304269 aatggtgggaccccttcccggaccctgcgtatgtgggagcttt-agtgcaccggattgccct 42304209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 286 - 349
Target Start/End: Original strand, 10668321 - 10668383
Alignment:
286 ataatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct 349  Q
    |||||||||| ||||||||| ||  |||| |||||||||||| ||||||||||||| |||||||    
10668321 ataatggtgggaccccttcccggtccctgcgtatgcgggagc-tttagtgcaccgggttgccct 10668383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 288 - 330
Target Start/End: Original strand, 11596608 - 11596650
Alignment:
288 aatggtggaaccccttcctggatcctgtgtatgcgggagcttt 330  Q
    |||||||| ||||||||||||| |||| |||||||||||||||    
11596608 aatggtgggaccccttcctggaccctgcgtatgcgggagcttt 11596650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 288 - 349
Target Start/End: Original strand, 35005221 - 35005281
Alignment:
288 aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct 349  Q
    |||||||| ||||||||| ||| |||| ||||||||| ||||| |||||||||| |||||||    
35005221 aatggtgggaccccttcccggaccctgcgtatgcgggcgcttt-agtgcaccgggttgccct 35005281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 288 - 349
Target Start/End: Complemental strand, 35253249 - 35253189
Alignment:
288 aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct 349  Q
    |||||||| ||||||||| ||| ||||  ||||||||||| | |||||||||||||||||||    
35253249 aatggtgggaccccttcccggaccctgcatatgcgggagc-tctagtgcaccggattgccct 35253189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 288 - 349
Target Start/End: Complemental strand, 46248015 - 46247955
Alignment:
288 aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct 349  Q
    |||||||| ||||||||| ||| |||| |||||||||||| ||||||| ||||| |||||||    
46248015 aatggtgggaccccttcccggaccctgcgtatgcgggagc-tttagtgtaccgggttgccct 46247955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 288 - 349
Target Start/End: Original strand, 50606499 - 50606559
Alignment:
288 aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct 349  Q
    |||||||| ||||||||| ||| ||||  ||||||||||| ||||||||||||| |||||||    
50606499 aatggtgggaccccttcccggaccctgcatatgcgggagc-tttagtgcaccgggttgccct 50606559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 288 - 328
Target Start/End: Complemental strand, 27136713 - 27136673
Alignment:
288 aatggtggaaccccttcctggatcctgtgtatgcgggagct 328  Q
    |||||||| |||||||||| |||| ||||||||||||||||    
27136713 aatggtgggaccccttcctagatcatgtgtatgcgggagct 27136673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 288 - 348
Target Start/End: Original strand, 45402192 - 45402251
Alignment:
288 aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccc 348  Q
    |||||||| |||||||||  || |||| |||||||||||| ||||||||||||| ||||||    
45402192 aatggtgggaccccttcccagaccctgcgtatgcgggagc-tttagtgcaccgggttgccc 45402251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 288 - 348
Target Start/End: Original strand, 46991900 - 46991959
Alignment:
288 aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccc 348  Q
    |||||||| ||||||||| ||| |||| ||||| ||||||||| |||||||||| ||||||    
46991900 aatggtgggaccccttcccggaccctgcgtatgtgggagcttt-agtgcaccgggttgccc 46991959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 7)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 286 - 349
Target Start/End: Original strand, 25622531 - 25622593
Alignment:
286 ataatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct 349  Q
    |||||||||| ||||||||| ||| |||| |||||||||||| |||||||||||||||||||||    
25622531 ataatggtgggaccccttcccggaccctgcgtatgcgggagc-tttagtgcaccggattgccct 25622593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 286 - 349
Target Start/End: Original strand, 38879654 - 38879716
Alignment:
286 ataatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct 349  Q
    |||||||||| ||||||||| ||| |||| |||||||||||| ||||||||||||| |||||||    
38879654 ataatggtgggaccccttcccggaccctgcgtatgcgggagc-tttagtgcaccgggttgccct 38879716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 288 - 349
Target Start/End: Original strand, 16957387 - 16957447
Alignment:
288 aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct 349  Q
    |||||||| ||||||||| ||| |||| |||||||||||| ||||||||||||| |||||||    
16957387 aatggtgggaccccttcccggaccctgcgtatgcgggagc-tttagtgcaccgggttgccct 16957447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 299 - 349
Target Start/End: Original strand, 32354211 - 32354260
Alignment:
299 cccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct 349  Q
    ||||||| ||| ||||||||||||||||| ||||||||||||| |||||||    
32354211 cccttcccggaccctgtgtatgcgggagc-tttagtgcaccgggttgccct 32354260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 288 - 333
Target Start/End: Original strand, 22600527 - 22600572
Alignment:
288 aatggtggaaccccttcctggatcctgtgtatgcgggagcttttag 333  Q
    |||||||| | ||||||| |||||||| ||||||||||||||||||    
22600527 aatggtgggatcccttcccggatcctgcgtatgcgggagcttttag 22600572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 288 - 349
Target Start/End: Original strand, 24448963 - 24449023
Alignment:
288 aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct 349  Q
    |||||||| ||||||||| ||| |||| |||||| |||||||| |||||||||| |||||||    
24448963 aatggtgggaccccttcccggaccctgcgtatgcaggagcttt-agtgcaccgggttgccct 24449023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 288 - 349
Target Start/End: Original strand, 41014391 - 41014451
Alignment:
288 aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct 349  Q
    |||||||| ||||||||||||| || |  ||||||||||| ||||||||||||| |||||||    
41014391 aatggtgggaccccttcctggaccccgcatatgcgggagc-tttagtgcaccgggttgccct 41014451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 10)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 286 - 349
Target Start/End: Complemental strand, 46421099 - 46421036
Alignment:
286 ataatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct 349  Q
    |||||||||| ||||||||| ||| |||| ||||||||||||||| |||||||||| |||||||    
46421099 ataatggtgggaccccttcccggaccctgcgtatgcgggagctttaagtgcaccggtttgccct 46421036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 286 - 349
Target Start/End: Complemental strand, 13628854 - 13628792
Alignment:
286 ataatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct 349  Q
    |||||||||| ||||||||| ||| |||| |||||||||||| ||||||||||||| |||||||    
13628854 ataatggtgggaccccttcccggaccctgcgtatgcgggagc-tttagtgcaccgggttgccct 13628792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 286 - 351
Target Start/End: Complemental strand, 8247751 - 8247686
Alignment:
286 ataatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccctat 351  Q
    |||||||||| || |||||| ||| |||| ||||||||||||||| ||||||| || |||||||||    
8247751 ataatggtgggactccttcccggaccctgcgtatgcgggagctttaagtgcactgggttgccctat 8247686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 288 - 349
Target Start/End: Complemental strand, 24851363 - 24851303
Alignment:
288 aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct 349  Q
    |||||||| ||||||||| ||||||||  ||||||||||| ||||||||||||| |||||||    
24851363 aatggtgggaccccttcccggatcctgcatatgcgggagc-tttagtgcaccgggttgccct 24851303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 288 - 349
Target Start/End: Complemental strand, 25517232 - 25517172
Alignment:
288 aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct 349  Q
    |||||||| ||||||||| |||||||| |||||| |||||||| |||||||||| |||||||    
25517232 aatggtgggaccccttcccggatcctgcgtatgctggagcttt-agtgcaccgggttgccct 25517172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 288 - 349
Target Start/End: Complemental strand, 40272874 - 40272814
Alignment:
288 aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct 349  Q
    |||||||| ||||||||| ||| |||| |||||||||||| ||||||||||||| |||||||    
40272874 aatggtgggaccccttcccggaccctgcgtatgcgggagc-tttagtgcaccgggttgccct 40272814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 288 - 349
Target Start/End: Original strand, 54484786 - 54484846
Alignment:
288 aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct 349  Q
    |||||||| ||||||||| ||| |||| |||||||||||| ||||||||||||| |||||||    
54484786 aatggtgggaccccttcccggaccctgcgtatgcgggagc-tttagtgcaccgggttgccct 54484846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 297 - 349
Target Start/End: Complemental strand, 10484669 - 10484618
Alignment:
297 accccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct 349  Q
    ||||||||||||| |||| |||||||||||| ||||||||||||| |||||||    
10484669 accccttcctggaccctgcgtatgcgggagc-tttagtgcaccgggttgccct 10484618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 288 - 329
Target Start/End: Complemental strand, 10795485 - 10795444
Alignment:
288 aatggtggaaccccttcctggatcctgtgtatgcgggagctt 329  Q
    |||||||| ||||||||||||| |||| ||||||||||||||    
10795485 aatggtgggaccccttcctggaccctgcgtatgcgggagctt 10795444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 286 - 350
Target Start/End: Complemental strand, 353413 - 353350
Alignment:
286 ataatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgcccta 350  Q
    |||||||||| ||||||||| ||| || |  ||||||||||| ||||||||||||| ||||||||    
353413 ataatggtgggaccccttcccggaccccgcatatgcgggagc-tttagtgcaccgggttgcccta 353350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 38; Significance: 0.000000000002; HSPs: 8)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 288 - 349
Target Start/End: Original strand, 35261752 - 35261812
Alignment:
288 aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct 349  Q
    |||||||| ||||||||||||| |||| |||||||||||| ||||||||||||| |||||||    
35261752 aatggtgggaccccttcctggaccctgcgtatgcgggagc-tttagtgcaccgggttgccct 35261812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 288 - 341
Target Start/End: Original strand, 44530222 - 44530274
Alignment:
288 aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccgg 341  Q
    |||||||| ||||||||||||| |||| |||||||||||| |||||||||||||    
44530222 aatggtgggaccccttcctggaccctgcgtatgcgggagc-tttagtgcaccgg 44530274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 286 - 341
Target Start/End: Complemental strand, 20284133 - 20284079
Alignment:
286 ataatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccgg 341  Q
    |||||||||| ||||||||| ||| |||| ||||||||||| ||||||||||||||    
20284133 ataatggtgggaccccttcccggaccctgcgtatgcgggag-ttttagtgcaccgg 20284079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 286 - 341
Target Start/End: Complemental strand, 21070761 - 21070707
Alignment:
286 ataatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccgg 341  Q
    |||||||||| ||||||||| ||| |||| ||||||||||| ||||||||||||||    
21070761 ataatggtgggaccccttcccggaccctgcgtatgcgggag-ttttagtgcaccgg 21070707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 286 - 349
Target Start/End: Complemental strand, 39461058 - 39460996
Alignment:
286 ataatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct 349  Q
    |||||||||  ||||||||| ||| |||| |||||||||||| ||||||||||||| |||||||    
39461058 ataatggtgagaccccttcccggaccctgcgtatgcgggagc-tttagtgcaccgggttgccct 39460996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 288 - 349
Target Start/End: Original strand, 12625963 - 12626023
Alignment:
288 aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct 349  Q
    |||||||| ||||| ||| ||| |||| |||||||||||| ||||||||||||| |||||||    
12625963 aatggtgggaccccctcccggaccctgcgtatgcgggagc-tttagtgcaccgggttgccct 12626023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 288 - 349
Target Start/End: Complemental strand, 28817688 - 28817628
Alignment:
288 aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct 349  Q
    |||||||| ||||||||| ||| |||| |||||||||||| ||||||||| ||| |||||||    
28817688 aatggtgggaccccttcccggaccctgcgtatgcgggagc-tttagtgcatcgggttgccct 28817628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 288 - 349
Target Start/End: Complemental strand, 35107373 - 35107313
Alignment:
288 aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct 349  Q
    |||||||| ||||||||| |||  |||||||||||| ||| ||||||||||||| |||||||    
35107373 aatggtgggaccccttcccggacgctgtgtatgcggaagc-tttagtgcaccgggttgccct 35107313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 36; Significance: 0.00000000003; HSPs: 4)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 286 - 349
Target Start/End: Original strand, 43557545 - 43557608
Alignment:
286 ataatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct 349  Q
    |||||||||| ||||| ||| |||  ||| |||||||||||||||||||||||||| |||||||    
43557545 ataatggtgggaccccctcccggactctgcgtatgcgggagcttttagtgcaccgggttgccct 43557608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 290 - 349
Target Start/End: Complemental strand, 45018983 - 45018925
Alignment:
290 tggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct 349  Q
    |||||||||||||||| ||| |||| |||||||||||| ||||||||||| | |||||||    
45018983 tggtggaaccccttcccggaccctgcgtatgcgggagc-tttagtgcaccaggttgccct 45018925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 288 - 349
Target Start/End: Original strand, 7879711 - 7879771
Alignment:
288 aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct 349  Q
    |||||||| ||||||||| ||| |||| |||||||||||| || |||||||||| |||||||    
7879711 aatggtgggaccccttcccggaccctgcgtatgcgggagc-ttcagtgcaccgggttgccct 7879771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 288 - 349
Target Start/End: Complemental strand, 11617650 - 11617590
Alignment:
288 aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct 349  Q
    |||||||| ||||||||||||| |||| |||||| ||| | ||||||||||||| |||||||    
11617650 aatggtgggaccccttcctggaccctgcgtatgcagga-cctttagtgcaccgggttgccct 11617590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 36; Significance: 0.00000000003; HSPs: 15)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 286 - 349
Target Start/End: Complemental strand, 38755972 - 38755910
Alignment:
286 ataatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct 349  Q
    |||||||||| ||||||||| ||| |||| |||||||||||| ||||||||||||| |||||||    
38755972 ataatggtgggaccccttcccggaccctgcgtatgcgggagc-tttagtgcaccgggttgccct 38755910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 288 - 349
Target Start/End: Complemental strand, 20639720 - 20639660
Alignment:
288 aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct 349  Q
    |||||||| ||||||||| ||| |||| |||||||||||| ||||||||||||| |||||||    
20639720 aatggtgggaccccttcccggaccctgcgtatgcgggagc-tttagtgcaccgggttgccct 20639660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 288 - 349
Target Start/End: Complemental strand, 44363192 - 44363132
Alignment:
288 aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct 349  Q
    |||||||| ||||||||| ||| |||| |||||||||||| ||||||||||||| |||||||    
44363192 aatggtgggaccccttcccggaccctgcgtatgcgggagc-tttagtgcaccgggttgccct 44363132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 286 - 349
Target Start/End: Complemental strand, 16408665 - 16408603
Alignment:
286 ataatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct 349  Q
    |||||||||||||||||||| ||| || |  ||||||||||| ||||||||||||| |||||||    
16408665 ataatggtggaaccccttcccggaccccgcatatgcgggagc-tttagtgcaccgggttgccct 16408603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 286 - 349
Target Start/End: Original strand, 23501860 - 23501922
Alignment:
286 ataatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct 349  Q
    |||||||||| ||||||||| ||| ||||  ||||||||||| ||||||||||||| |||||||    
23501860 ataatggtgggaccccttcccggaccctgcatatgcgggagc-tttagtgcaccgggttgccct 23501922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 286 - 349
Target Start/End: Complemental strand, 33836551 - 33836489
Alignment:
286 ataatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct 349  Q
    |||||||||| ||||||||| ||| |||| |||||||||||| ||||||||| ||| |||||||    
33836551 ataatggtgggaccccttcccggaccctgcgtatgcgggagc-tttagtgcaacgggttgccct 33836489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 286 - 341
Target Start/End: Complemental strand, 50555720 - 50555666
Alignment:
286 ataatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccgg 341  Q
    |||||||||||||||||||| ||| |||| |||||| |||| ||||||||||||||    
50555720 ataatggtggaaccccttcccggaccctgcgtatgcaggag-ttttagtgcaccgg 50555666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 286 - 349
Target Start/End: Original strand, 54730323 - 54730385
Alignment:
286 ataatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct 349  Q
    |||||| ||||||||||||| ||| |||| |||||||||||| |||||||||||| ||| ||||    
54730323 ataatgatggaaccccttcccggaccctgcgtatgcgggagc-tttagtgcaccgaattaccct 54730385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 291 - 349
Target Start/End: Complemental strand, 36816443 - 36816386
Alignment:
291 ggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct 349  Q
    ||||| || |||||||||| ||||||||||||||||| ||||||| ||||| |||||||    
36816443 ggtgggactccttcctggaccctgtgtatgcgggagc-tttagtgtaccgggttgccct 36816386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 316 - 349
Target Start/End: Original strand, 2813228 - 2813261
Alignment:
316 gtatgcgggagcttttagtgcaccggattgccct 349  Q
    ||||||||||||||| ||||||||||||||||||    
2813228 gtatgcgggagctttaagtgcaccggattgccct 2813261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 288 - 349
Target Start/End: Original strand, 11394925 - 11394985
Alignment:
288 aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct 349  Q
    |||||||| ||||||| | ||| |||| |||||||||||| ||||||||||||| |||||||    
11394925 aatggtgggacccctttccggaccctgcgtatgcgggagc-tttagtgcaccgggttgccct 11394985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 288 - 349
Target Start/End: Original strand, 11404652 - 11404712
Alignment:
288 aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct 349  Q
    |||||||| ||||||| | ||| |||| |||||||||||| ||||||||||||| |||||||    
11404652 aatggtgggacccctttccggaccctgcgtatgcgggagc-tttagtgcaccgggttgccct 11404712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 288 - 349
Target Start/End: Original strand, 40915901 - 40915961
Alignment:
288 aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct 349  Q
    |||||||| | ||||||| ||| |||| |||||||||||| || ||||||||||||||||||    
40915901 aatggtgggagcccttcccggaccctgcgtatgcgggagc-ttcagtgcaccggattgccct 40915961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 289 - 349
Target Start/End: Original strand, 32484307 - 32484366
Alignment:
289 atggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct 349  Q
    ||||||| ||||||||| ||| ||||  ||||||||||| ||||||||||||| |||||||    
32484307 atggtgggaccccttcccggaccctgcatatgcgggagc-tttagtgcaccgggttgccct 32484366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 297 - 349
Target Start/End: Complemental strand, 40553990 - 40553939
Alignment:
297 accccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct 349  Q
    ||||||||| ||| |||| |||||||||||| ||||||||||||| |||||||    
40553990 accccttcccggaccctgcgtatgcgggagc-tttagtgcaccgggttgccct 40553939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0057 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: scaffold0057
Description:

Target: scaffold0057; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 288 - 349
Target Start/End: Original strand, 46904 - 46964
Alignment:
288 aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct 349  Q
    |||||||| ||||||||| ||| |||| |||||||||||| ||||||||||||| |||||||    
46904 aatggtgggaccccttcccggaccctgcgtatgcgggagc-tttagtgcaccgggttgccct 46964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0180 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0180
Description:

Target: scaffold0180; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 288 - 349
Target Start/End: Complemental strand, 24195 - 24135
Alignment:
288 aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct 349  Q
    |||||||| ||||||||| ||| ||||  ||||||||||| | |||||||||||||||||||    
24195 aatggtgggaccccttcccggaccctgcatatgcgggagc-tctagtgcaccggattgccct 24135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University