View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19556_high_16 (Length: 362)
Name: NF19556_high_16
Description: NF19556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19556_high_16 |
 |  |
|
| [»] scaffold0057 (1 HSPs) |
 |  |  |
|
| [»] scaffold0180 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 264; Significance: 1e-147; HSPs: 12)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 18 - 349
Target Start/End: Original strand, 1288824 - 1289156
Alignment:
| Q |
18 |
ctaagtgagcgtgtattctttaaactttcatccaatataatttcaggttccattgtattacatgccacttgtgatatgtattgtaaatttaggaaatcat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
1288824 |
ctaagtgagcgtgtattctttaaactttcatccagtataatttcaggttccattgtattacatgccacttgcgatatgtattgtaaatttaggaaatcat |
1288923 |
T |
 |
| Q |
118 |
gaactagaaggaaaataaagacttcaagtctaaaccttcccagcccagtaaatgtatcccaaataataatgcttgaaaaataattagttattcaatagta |
217 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1288924 |
gaaccagaaggaaaataaagacttcaagtctaaaccatcccagcccagtaaatgtatcccaaataataatgcttgaaaaataattagttattcaatagta |
1289023 |
T |
 |
| Q |
218 |
atacattaagctagtttattgtatggaattgattaacatcattaagattggatatgagcaa-nnnnnnnataatggtggaaccccttcctggatcctgtg |
316 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||| ||||| || |
|
|
| T |
1289024 |
atacattaagctagtttattgcatggaattgattaacatcattaagattggatatgagcaattttttttataatggtgggaccccttcccggatcatgca |
1289123 |
T |
 |
| Q |
317 |
tatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
1289124 |
tatgcgggagcttttagtgcaccggattgccct |
1289156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 286 - 349
Target Start/End: Original strand, 14530391 - 14530453
Alignment:
| Q |
286 |
ataatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
|||||||||| ||||||||| ||| |||| |||||||||||| ||||||||||||| ||||||| |
|
|
| T |
14530391 |
ataatggtgggaccccttcccggaccctgcgtatgcgggagc-tttagtgcaccgggttgccct |
14530453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 288 - 330
Target Start/End: Complemental strand, 19185805 - 19185763
Alignment:
| Q |
288 |
aatggtggaaccccttcctggatcctgtgtatgcgggagcttt |
330 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
19185805 |
aatggtggaaccccttcctggaccctgcgtatgcgggagcttt |
19185763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 288 - 349
Target Start/End: Original strand, 9671252 - 9671312
Alignment:
| Q |
288 |
aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
|||||||| ||||||||| ||| |||| |||||||||||| ||||||||||||| ||||||| |
|
|
| T |
9671252 |
aatggtgggaccccttcccggaccctgcgtatgcgggagc-tttagtgcaccgggttgccct |
9671312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 288 - 349
Target Start/End: Original strand, 10543773 - 10543833
Alignment:
| Q |
288 |
aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
|||||||| ||||||||| ||| |||| |||||||||||| ||||||||||||| ||||||| |
|
|
| T |
10543773 |
aatggtgggaccccttcccggaccctgcgtatgcgggagc-tttagtgcaccgggttgccct |
10543833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 288 - 349
Target Start/End: Original strand, 10546236 - 10546296
Alignment:
| Q |
288 |
aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
|||||||| ||||||||| ||| |||| |||||||||||| ||||||||||||| ||||||| |
|
|
| T |
10546236 |
aatggtgggaccccttcccggaccctgcgtatgcgggagc-tttagtgcaccgggttgccct |
10546296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 289 - 349
Target Start/End: Complemental strand, 40579810 - 40579751
Alignment:
| Q |
289 |
atggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
||||||| ||||||||| ||| |||| |||||||||||| ||||||||||||| ||||||| |
|
|
| T |
40579810 |
atggtgggaccccttcccggaccctgagtatgcgggagc-tttagtgcaccgggttgccct |
40579751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 288 - 347
Target Start/End: Complemental strand, 24860050 - 24859992
Alignment:
| Q |
288 |
aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgcc |
347 |
Q |
| |
|
|||||| |||||||||| ||| |||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
24860050 |
aatggtagaaccccttctcggaccctgcgtatgcgggagc-tttagtgcaccggattgcc |
24859992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 288 - 349
Target Start/End: Complemental strand, 8455378 - 8455318
Alignment:
| Q |
288 |
aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
|||||||| ||||||||| ||| |||| |||||| |||||||| |||||||||| ||||||| |
|
|
| T |
8455378 |
aatggtgggaccccttcccggaccctgcgtatgccggagcttt-agtgcaccgggttgccct |
8455318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 288 - 349
Target Start/End: Original strand, 14444801 - 14444861
Alignment:
| Q |
288 |
aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
|||||||| ||||||||| ||| |||| |||||||||||| ||||||||||| | ||||||| |
|
|
| T |
14444801 |
aatggtgggaccccttcccggaccctgcgtatgcgggagc-tttagtgcaccaggttgccct |
14444861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 288 - 349
Target Start/End: Original strand, 36871565 - 36871624
Alignment:
| Q |
288 |
aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
|||||||| ||||||||| ||| |||| ||||||||||||||| |||||||||| ||||||| |
|
|
| T |
36871565 |
aatggtgggaccccttcccgga-cctgcgtatgcgggagcttt-agtgcaccgggttgccct |
36871624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 288 - 349
Target Start/End: Complemental strand, 40762296 - 40762236
Alignment:
| Q |
288 |
aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
|||||||| |||| |||||||| |||| ||||| ||||||||| |||||||||| ||||||| |
|
|
| T |
40762296 |
aatggtgggaccctttcctggaccctgcgtatgtgggagcttt-agtgcaccgggttgccct |
40762236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 44; Significance: 6e-16; HSPs: 6)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 286 - 349
Target Start/End: Complemental strand, 12221979 - 12221916
Alignment:
| Q |
286 |
ataatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
|||||||||| ||||||||| ||| |||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
12221979 |
ataatggtgggaccccttcccggaccctgcgtatgcgggagcttttagtgcaccgggttgccct |
12221916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 287 - 349
Target Start/End: Original strand, 6808467 - 6808528
Alignment:
| Q |
287 |
taatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
||||||||| ||||||||| ||| ||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
6808467 |
taatggtgggaccccttcccggaccctgtgtatgcgggagc-tttagtgcaccgggttgccct |
6808528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 286 - 349
Target Start/End: Complemental strand, 29355919 - 29355857
Alignment:
| Q |
286 |
ataatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
|||||||||| ||||||||| ||| |||| |||||||||||| ||||||||||||| ||||||| |
|
|
| T |
29355919 |
ataatggtgggaccccttcccggaccctgcgtatgcgggagc-tttagtgcaccgggttgccct |
29355857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 288 - 349
Target Start/End: Original strand, 13267798 - 13267858
Alignment:
| Q |
288 |
aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
|||||||| ||||||||||||| |||| |||||||||||| || |||||||||| ||||||| |
|
|
| T |
13267798 |
aatggtgggaccccttcctggaccctgcgtatgcgggagc-ttcagtgcaccgggttgccct |
13267858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 288 - 349
Target Start/End: Original strand, 1941928 - 1941988
Alignment:
| Q |
288 |
aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
|||||||| ||||| ||||||||| |||||||||||||| |||| |||||||| ||||||| |
|
|
| T |
1941928 |
aatggtgggaccccatcctggatcttgtgtatgcgggag-tttttgtgcaccgtgttgccct |
1941988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 290 - 330
Target Start/End: Original strand, 11395836 - 11395876
Alignment:
| Q |
290 |
tggtggaaccccttcctggatcctgtgtatgcgggagcttt |
330 |
Q |
| |
|
|||||| ||||||||| |||||||| ||||||||||||||| |
|
|
| T |
11395836 |
tggtgggaccccttcccggatcctgcgtatgcgggagcttt |
11395876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 42; Significance: 0.000000000000009; HSPs: 15)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 288 - 349
Target Start/End: Original strand, 18944741 - 18944802
Alignment:
| Q |
288 |
aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
|||||||| ||||||||| ||| |||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
18944741 |
aatggtgggaccccttcccggaccctgcgtatgcgggagcttttagtgcaccgggttgccct |
18944802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 288 - 330
Target Start/End: Complemental strand, 4430061 - 4430019
Alignment:
| Q |
288 |
aatggtggaaccccttcctggatcctgtgtatgcgggagcttt |
330 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
4430061 |
aatggtggaacccctttctggatcctgtgtatgcgggagcttt |
4430019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 288 - 349
Target Start/End: Original strand, 27474376 - 27474436
Alignment:
| Q |
288 |
aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
|||||||| ||||||||| ||| |||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
27474376 |
aatggtgggaccccttcccggaccctgcgtatgcgggagc-tttagtgcaccggattgccct |
27474436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 288 - 349
Target Start/End: Original strand, 4349734 - 4349794
Alignment:
| Q |
288 |
aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
|||||||| ||||||||| ||| |||| |||||||||||| ||||||||||||| ||||||| |
|
|
| T |
4349734 |
aatggtgggaccccttcccggaccctgcgtatgcgggagc-tttagtgcaccgggttgccct |
4349794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 288 - 349
Target Start/End: Complemental strand, 41440664 - 41440604
Alignment:
| Q |
288 |
aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||| ||||||| |||||| |||||| |
|
|
| T |
41440664 |
aatggtggaaccccttcctagactctgtgtatgcgggagc-tttagtgaaccggactgccct |
41440604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 288 - 349
Target Start/End: Complemental strand, 42304269 - 42304209
Alignment:
| Q |
288 |
aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
|||||||| ||||||||| ||| |||| ||||| ||||||||| |||||||||||||||||| |
|
|
| T |
42304269 |
aatggtgggaccccttcccggaccctgcgtatgtgggagcttt-agtgcaccggattgccct |
42304209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 286 - 349
Target Start/End: Original strand, 10668321 - 10668383
Alignment:
| Q |
286 |
ataatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
|||||||||| ||||||||| || |||| |||||||||||| ||||||||||||| ||||||| |
|
|
| T |
10668321 |
ataatggtgggaccccttcccggtccctgcgtatgcgggagc-tttagtgcaccgggttgccct |
10668383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 288 - 330
Target Start/End: Original strand, 11596608 - 11596650
Alignment:
| Q |
288 |
aatggtggaaccccttcctggatcctgtgtatgcgggagcttt |
330 |
Q |
| |
|
|||||||| ||||||||||||| |||| ||||||||||||||| |
|
|
| T |
11596608 |
aatggtgggaccccttcctggaccctgcgtatgcgggagcttt |
11596650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 288 - 349
Target Start/End: Original strand, 35005221 - 35005281
Alignment:
| Q |
288 |
aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
|||||||| ||||||||| ||| |||| ||||||||| ||||| |||||||||| ||||||| |
|
|
| T |
35005221 |
aatggtgggaccccttcccggaccctgcgtatgcgggcgcttt-agtgcaccgggttgccct |
35005281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 288 - 349
Target Start/End: Complemental strand, 35253249 - 35253189
Alignment:
| Q |
288 |
aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
|||||||| ||||||||| ||| |||| ||||||||||| | ||||||||||||||||||| |
|
|
| T |
35253249 |
aatggtgggaccccttcccggaccctgcatatgcgggagc-tctagtgcaccggattgccct |
35253189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 288 - 349
Target Start/End: Complemental strand, 46248015 - 46247955
Alignment:
| Q |
288 |
aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
|||||||| ||||||||| ||| |||| |||||||||||| ||||||| ||||| ||||||| |
|
|
| T |
46248015 |
aatggtgggaccccttcccggaccctgcgtatgcgggagc-tttagtgtaccgggttgccct |
46247955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 288 - 349
Target Start/End: Original strand, 50606499 - 50606559
Alignment:
| Q |
288 |
aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
|||||||| ||||||||| ||| |||| ||||||||||| ||||||||||||| ||||||| |
|
|
| T |
50606499 |
aatggtgggaccccttcccggaccctgcatatgcgggagc-tttagtgcaccgggttgccct |
50606559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 288 - 328
Target Start/End: Complemental strand, 27136713 - 27136673
Alignment:
| Q |
288 |
aatggtggaaccccttcctggatcctgtgtatgcgggagct |
328 |
Q |
| |
|
|||||||| |||||||||| |||| |||||||||||||||| |
|
|
| T |
27136713 |
aatggtgggaccccttcctagatcatgtgtatgcgggagct |
27136673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 288 - 348
Target Start/End: Original strand, 45402192 - 45402251
Alignment:
| Q |
288 |
aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccc |
348 |
Q |
| |
|
|||||||| ||||||||| || |||| |||||||||||| ||||||||||||| |||||| |
|
|
| T |
45402192 |
aatggtgggaccccttcccagaccctgcgtatgcgggagc-tttagtgcaccgggttgccc |
45402251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 288 - 348
Target Start/End: Original strand, 46991900 - 46991959
Alignment:
| Q |
288 |
aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccc |
348 |
Q |
| |
|
|||||||| ||||||||| ||| |||| ||||| ||||||||| |||||||||| |||||| |
|
|
| T |
46991900 |
aatggtgggaccccttcccggaccctgcgtatgtgggagcttt-agtgcaccgggttgccc |
46991959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 7)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 286 - 349
Target Start/End: Original strand, 25622531 - 25622593
Alignment:
| Q |
286 |
ataatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
|||||||||| ||||||||| ||| |||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
25622531 |
ataatggtgggaccccttcccggaccctgcgtatgcgggagc-tttagtgcaccggattgccct |
25622593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 286 - 349
Target Start/End: Original strand, 38879654 - 38879716
Alignment:
| Q |
286 |
ataatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
|||||||||| ||||||||| ||| |||| |||||||||||| ||||||||||||| ||||||| |
|
|
| T |
38879654 |
ataatggtgggaccccttcccggaccctgcgtatgcgggagc-tttagtgcaccgggttgccct |
38879716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 288 - 349
Target Start/End: Original strand, 16957387 - 16957447
Alignment:
| Q |
288 |
aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
|||||||| ||||||||| ||| |||| |||||||||||| ||||||||||||| ||||||| |
|
|
| T |
16957387 |
aatggtgggaccccttcccggaccctgcgtatgcgggagc-tttagtgcaccgggttgccct |
16957447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 299 - 349
Target Start/End: Original strand, 32354211 - 32354260
Alignment:
| Q |
299 |
cccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
||||||| ||| ||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
32354211 |
cccttcccggaccctgtgtatgcgggagc-tttagtgcaccgggttgccct |
32354260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 288 - 333
Target Start/End: Original strand, 22600527 - 22600572
Alignment:
| Q |
288 |
aatggtggaaccccttcctggatcctgtgtatgcgggagcttttag |
333 |
Q |
| |
|
|||||||| | ||||||| |||||||| |||||||||||||||||| |
|
|
| T |
22600527 |
aatggtgggatcccttcccggatcctgcgtatgcgggagcttttag |
22600572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 288 - 349
Target Start/End: Original strand, 24448963 - 24449023
Alignment:
| Q |
288 |
aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
|||||||| ||||||||| ||| |||| |||||| |||||||| |||||||||| ||||||| |
|
|
| T |
24448963 |
aatggtgggaccccttcccggaccctgcgtatgcaggagcttt-agtgcaccgggttgccct |
24449023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 288 - 349
Target Start/End: Original strand, 41014391 - 41014451
Alignment:
| Q |
288 |
aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
|||||||| ||||||||||||| || | ||||||||||| ||||||||||||| ||||||| |
|
|
| T |
41014391 |
aatggtgggaccccttcctggaccccgcatatgcgggagc-tttagtgcaccgggttgccct |
41014451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 10)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 286 - 349
Target Start/End: Complemental strand, 46421099 - 46421036
Alignment:
| Q |
286 |
ataatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
|||||||||| ||||||||| ||| |||| ||||||||||||||| |||||||||| ||||||| |
|
|
| T |
46421099 |
ataatggtgggaccccttcccggaccctgcgtatgcgggagctttaagtgcaccggtttgccct |
46421036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 286 - 349
Target Start/End: Complemental strand, 13628854 - 13628792
Alignment:
| Q |
286 |
ataatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
|||||||||| ||||||||| ||| |||| |||||||||||| ||||||||||||| ||||||| |
|
|
| T |
13628854 |
ataatggtgggaccccttcccggaccctgcgtatgcgggagc-tttagtgcaccgggttgccct |
13628792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 286 - 351
Target Start/End: Complemental strand, 8247751 - 8247686
Alignment:
| Q |
286 |
ataatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccctat |
351 |
Q |
| |
|
|||||||||| || |||||| ||| |||| ||||||||||||||| ||||||| || ||||||||| |
|
|
| T |
8247751 |
ataatggtgggactccttcccggaccctgcgtatgcgggagctttaagtgcactgggttgccctat |
8247686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 288 - 349
Target Start/End: Complemental strand, 24851363 - 24851303
Alignment:
| Q |
288 |
aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
|||||||| ||||||||| |||||||| ||||||||||| ||||||||||||| ||||||| |
|
|
| T |
24851363 |
aatggtgggaccccttcccggatcctgcatatgcgggagc-tttagtgcaccgggttgccct |
24851303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 288 - 349
Target Start/End: Complemental strand, 25517232 - 25517172
Alignment:
| Q |
288 |
aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
|||||||| ||||||||| |||||||| |||||| |||||||| |||||||||| ||||||| |
|
|
| T |
25517232 |
aatggtgggaccccttcccggatcctgcgtatgctggagcttt-agtgcaccgggttgccct |
25517172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 288 - 349
Target Start/End: Complemental strand, 40272874 - 40272814
Alignment:
| Q |
288 |
aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
|||||||| ||||||||| ||| |||| |||||||||||| ||||||||||||| ||||||| |
|
|
| T |
40272874 |
aatggtgggaccccttcccggaccctgcgtatgcgggagc-tttagtgcaccgggttgccct |
40272814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 288 - 349
Target Start/End: Original strand, 54484786 - 54484846
Alignment:
| Q |
288 |
aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
|||||||| ||||||||| ||| |||| |||||||||||| ||||||||||||| ||||||| |
|
|
| T |
54484786 |
aatggtgggaccccttcccggaccctgcgtatgcgggagc-tttagtgcaccgggttgccct |
54484846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 297 - 349
Target Start/End: Complemental strand, 10484669 - 10484618
Alignment:
| Q |
297 |
accccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
||||||||||||| |||| |||||||||||| ||||||||||||| ||||||| |
|
|
| T |
10484669 |
accccttcctggaccctgcgtatgcgggagc-tttagtgcaccgggttgccct |
10484618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 288 - 329
Target Start/End: Complemental strand, 10795485 - 10795444
Alignment:
| Q |
288 |
aatggtggaaccccttcctggatcctgtgtatgcgggagctt |
329 |
Q |
| |
|
|||||||| ||||||||||||| |||| |||||||||||||| |
|
|
| T |
10795485 |
aatggtgggaccccttcctggaccctgcgtatgcgggagctt |
10795444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 286 - 350
Target Start/End: Complemental strand, 353413 - 353350
Alignment:
| Q |
286 |
ataatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgcccta |
350 |
Q |
| |
|
|||||||||| ||||||||| ||| || | ||||||||||| ||||||||||||| |||||||| |
|
|
| T |
353413 |
ataatggtgggaccccttcccggaccccgcatatgcgggagc-tttagtgcaccgggttgcccta |
353350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000002; HSPs: 8)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 288 - 349
Target Start/End: Original strand, 35261752 - 35261812
Alignment:
| Q |
288 |
aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
|||||||| ||||||||||||| |||| |||||||||||| ||||||||||||| ||||||| |
|
|
| T |
35261752 |
aatggtgggaccccttcctggaccctgcgtatgcgggagc-tttagtgcaccgggttgccct |
35261812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 288 - 341
Target Start/End: Original strand, 44530222 - 44530274
Alignment:
| Q |
288 |
aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccgg |
341 |
Q |
| |
|
|||||||| ||||||||||||| |||| |||||||||||| ||||||||||||| |
|
|
| T |
44530222 |
aatggtgggaccccttcctggaccctgcgtatgcgggagc-tttagtgcaccgg |
44530274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 286 - 341
Target Start/End: Complemental strand, 20284133 - 20284079
Alignment:
| Q |
286 |
ataatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccgg |
341 |
Q |
| |
|
|||||||||| ||||||||| ||| |||| ||||||||||| |||||||||||||| |
|
|
| T |
20284133 |
ataatggtgggaccccttcccggaccctgcgtatgcgggag-ttttagtgcaccgg |
20284079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 286 - 341
Target Start/End: Complemental strand, 21070761 - 21070707
Alignment:
| Q |
286 |
ataatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccgg |
341 |
Q |
| |
|
|||||||||| ||||||||| ||| |||| ||||||||||| |||||||||||||| |
|
|
| T |
21070761 |
ataatggtgggaccccttcccggaccctgcgtatgcgggag-ttttagtgcaccgg |
21070707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 286 - 349
Target Start/End: Complemental strand, 39461058 - 39460996
Alignment:
| Q |
286 |
ataatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
||||||||| ||||||||| ||| |||| |||||||||||| ||||||||||||| ||||||| |
|
|
| T |
39461058 |
ataatggtgagaccccttcccggaccctgcgtatgcgggagc-tttagtgcaccgggttgccct |
39460996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 288 - 349
Target Start/End: Original strand, 12625963 - 12626023
Alignment:
| Q |
288 |
aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
|||||||| ||||| ||| ||| |||| |||||||||||| ||||||||||||| ||||||| |
|
|
| T |
12625963 |
aatggtgggaccccctcccggaccctgcgtatgcgggagc-tttagtgcaccgggttgccct |
12626023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 288 - 349
Target Start/End: Complemental strand, 28817688 - 28817628
Alignment:
| Q |
288 |
aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
|||||||| ||||||||| ||| |||| |||||||||||| ||||||||| ||| ||||||| |
|
|
| T |
28817688 |
aatggtgggaccccttcccggaccctgcgtatgcgggagc-tttagtgcatcgggttgccct |
28817628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 288 - 349
Target Start/End: Complemental strand, 35107373 - 35107313
Alignment:
| Q |
288 |
aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
|||||||| ||||||||| ||| |||||||||||| ||| ||||||||||||| ||||||| |
|
|
| T |
35107373 |
aatggtgggaccccttcccggacgctgtgtatgcggaagc-tttagtgcaccgggttgccct |
35107313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000003; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 286 - 349
Target Start/End: Original strand, 43557545 - 43557608
Alignment:
| Q |
286 |
ataatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
|||||||||| ||||| ||| ||| ||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
43557545 |
ataatggtgggaccccctcccggactctgcgtatgcgggagcttttagtgcaccgggttgccct |
43557608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 290 - 349
Target Start/End: Complemental strand, 45018983 - 45018925
Alignment:
| Q |
290 |
tggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
|||||||||||||||| ||| |||| |||||||||||| ||||||||||| | ||||||| |
|
|
| T |
45018983 |
tggtggaaccccttcccggaccctgcgtatgcgggagc-tttagtgcaccaggttgccct |
45018925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 288 - 349
Target Start/End: Original strand, 7879711 - 7879771
Alignment:
| Q |
288 |
aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
|||||||| ||||||||| ||| |||| |||||||||||| || |||||||||| ||||||| |
|
|
| T |
7879711 |
aatggtgggaccccttcccggaccctgcgtatgcgggagc-ttcagtgcaccgggttgccct |
7879771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 288 - 349
Target Start/End: Complemental strand, 11617650 - 11617590
Alignment:
| Q |
288 |
aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
|||||||| ||||||||||||| |||| |||||| ||| | ||||||||||||| ||||||| |
|
|
| T |
11617650 |
aatggtgggaccccttcctggaccctgcgtatgcagga-cctttagtgcaccgggttgccct |
11617590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000003; HSPs: 15)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 286 - 349
Target Start/End: Complemental strand, 38755972 - 38755910
Alignment:
| Q |
286 |
ataatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
|||||||||| ||||||||| ||| |||| |||||||||||| ||||||||||||| ||||||| |
|
|
| T |
38755972 |
ataatggtgggaccccttcccggaccctgcgtatgcgggagc-tttagtgcaccgggttgccct |
38755910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 288 - 349
Target Start/End: Complemental strand, 20639720 - 20639660
Alignment:
| Q |
288 |
aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
|||||||| ||||||||| ||| |||| |||||||||||| ||||||||||||| ||||||| |
|
|
| T |
20639720 |
aatggtgggaccccttcccggaccctgcgtatgcgggagc-tttagtgcaccgggttgccct |
20639660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 288 - 349
Target Start/End: Complemental strand, 44363192 - 44363132
Alignment:
| Q |
288 |
aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
|||||||| ||||||||| ||| |||| |||||||||||| ||||||||||||| ||||||| |
|
|
| T |
44363192 |
aatggtgggaccccttcccggaccctgcgtatgcgggagc-tttagtgcaccgggttgccct |
44363132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 286 - 349
Target Start/End: Complemental strand, 16408665 - 16408603
Alignment:
| Q |
286 |
ataatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
|||||||||||||||||||| ||| || | ||||||||||| ||||||||||||| ||||||| |
|
|
| T |
16408665 |
ataatggtggaaccccttcccggaccccgcatatgcgggagc-tttagtgcaccgggttgccct |
16408603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 286 - 349
Target Start/End: Original strand, 23501860 - 23501922
Alignment:
| Q |
286 |
ataatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
|||||||||| ||||||||| ||| |||| ||||||||||| ||||||||||||| ||||||| |
|
|
| T |
23501860 |
ataatggtgggaccccttcccggaccctgcatatgcgggagc-tttagtgcaccgggttgccct |
23501922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 286 - 349
Target Start/End: Complemental strand, 33836551 - 33836489
Alignment:
| Q |
286 |
ataatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
|||||||||| ||||||||| ||| |||| |||||||||||| ||||||||| ||| ||||||| |
|
|
| T |
33836551 |
ataatggtgggaccccttcccggaccctgcgtatgcgggagc-tttagtgcaacgggttgccct |
33836489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 286 - 341
Target Start/End: Complemental strand, 50555720 - 50555666
Alignment:
| Q |
286 |
ataatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccgg |
341 |
Q |
| |
|
|||||||||||||||||||| ||| |||| |||||| |||| |||||||||||||| |
|
|
| T |
50555720 |
ataatggtggaaccccttcccggaccctgcgtatgcaggag-ttttagtgcaccgg |
50555666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 286 - 349
Target Start/End: Original strand, 54730323 - 54730385
Alignment:
| Q |
286 |
ataatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
|||||| ||||||||||||| ||| |||| |||||||||||| |||||||||||| ||| |||| |
|
|
| T |
54730323 |
ataatgatggaaccccttcccggaccctgcgtatgcgggagc-tttagtgcaccgaattaccct |
54730385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 291 - 349
Target Start/End: Complemental strand, 36816443 - 36816386
Alignment:
| Q |
291 |
ggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
||||| || |||||||||| ||||||||||||||||| ||||||| ||||| ||||||| |
|
|
| T |
36816443 |
ggtgggactccttcctggaccctgtgtatgcgggagc-tttagtgtaccgggttgccct |
36816386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 316 - 349
Target Start/End: Original strand, 2813228 - 2813261
Alignment:
| Q |
316 |
gtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |
|
|
| T |
2813228 |
gtatgcgggagctttaagtgcaccggattgccct |
2813261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 288 - 349
Target Start/End: Original strand, 11394925 - 11394985
Alignment:
| Q |
288 |
aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
|||||||| ||||||| | ||| |||| |||||||||||| ||||||||||||| ||||||| |
|
|
| T |
11394925 |
aatggtgggacccctttccggaccctgcgtatgcgggagc-tttagtgcaccgggttgccct |
11394985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 288 - 349
Target Start/End: Original strand, 11404652 - 11404712
Alignment:
| Q |
288 |
aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
|||||||| ||||||| | ||| |||| |||||||||||| ||||||||||||| ||||||| |
|
|
| T |
11404652 |
aatggtgggacccctttccggaccctgcgtatgcgggagc-tttagtgcaccgggttgccct |
11404712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 288 - 349
Target Start/End: Original strand, 40915901 - 40915961
Alignment:
| Q |
288 |
aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
|||||||| | ||||||| ||| |||| |||||||||||| || |||||||||||||||||| |
|
|
| T |
40915901 |
aatggtgggagcccttcccggaccctgcgtatgcgggagc-ttcagtgcaccggattgccct |
40915961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 289 - 349
Target Start/End: Original strand, 32484307 - 32484366
Alignment:
| Q |
289 |
atggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
||||||| ||||||||| ||| |||| ||||||||||| ||||||||||||| ||||||| |
|
|
| T |
32484307 |
atggtgggaccccttcccggaccctgcatatgcgggagc-tttagtgcaccgggttgccct |
32484366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 297 - 349
Target Start/End: Complemental strand, 40553990 - 40553939
Alignment:
| Q |
297 |
accccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
||||||||| ||| |||| |||||||||||| ||||||||||||| ||||||| |
|
|
| T |
40553990 |
accccttcccggaccctgcgtatgcgggagc-tttagtgcaccgggttgccct |
40553939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: scaffold0057
Description:
Target: scaffold0057; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 288 - 349
Target Start/End: Original strand, 46904 - 46964
Alignment:
| Q |
288 |
aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
|||||||| ||||||||| ||| |||| |||||||||||| ||||||||||||| ||||||| |
|
|
| T |
46904 |
aatggtgggaccccttcccggaccctgcgtatgcgggagc-tttagtgcaccgggttgccct |
46964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0180 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0180
Description:
Target: scaffold0180; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 288 - 349
Target Start/End: Complemental strand, 24195 - 24135
Alignment:
| Q |
288 |
aatggtggaaccccttcctggatcctgtgtatgcgggagcttttagtgcaccggattgccct |
349 |
Q |
| |
|
|||||||| ||||||||| ||| |||| ||||||||||| | ||||||||||||||||||| |
|
|
| T |
24195 |
aatggtgggaccccttcccggaccctgcatatgcgggagc-tctagtgcaccggattgccct |
24135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University