View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19556_high_23 (Length: 318)
Name: NF19556_high_23
Description: NF19556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19556_high_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 23 - 307
Target Start/End: Original strand, 8124740 - 8125024
Alignment:
| Q |
23 |
agcttgcacttaaataggataaatggtatggccaaggttcttggagtacttgcttctgttggaggagcttcaatcattaccctttacaagggacctacca |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8124740 |
agcttgcacttaaataggataaatggtatggccaaggttcttggagtacttgcttctgttggaggagcttcaatcattaccctttacaagggacctacca |
8124839 |
T |
 |
| Q |
123 |
tttatgctccacatttagcactacatcaaggacaaattttcttgtctgcatttgaggatgccaatgggaaaaacttgaacttgggtggcatccttctctt |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8124840 |
tttatgctccacatttagcactacatcaaggacaaattttcttgtctgcatttgaggatgccaatgggaaaaacttgaacttgggtggcatccttctctt |
8124939 |
T |
 |
| Q |
223 |
tggtcattgtttgtgttggtctggttggattgtgatgcaagcatttgttctgaaaaagtactcagcacaactcacaggttctgct |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
8124940 |
tggtcattgtttgtgttggtctggttggattgtgatgcaagcatttgttctgaaaaagtactcagcacaactcacagtttctgct |
8125024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University