View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19556_low_11 (Length: 404)
Name: NF19556_low_11
Description: NF19556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19556_low_11 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 119; Significance: 1e-60; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 213 - 392
Target Start/End: Complemental strand, 3948416 - 3948229
Alignment:
| Q |
213 |
atcaaacacattgttcagttcaaaaagcatctcattttaagagtacaagcaaacaaccaagcatttgaggaagaatcagcaaaagaaaaggggatgaaag |
312 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||||||||||||||||||||||||||| ||||| ||||| ||||||||||| || |||||||||||| |
|
|
| T |
3948416 |
atcaaacacattgtgcatttcaaaaagcatctcattttaagagtacaagcaaacaaccaaacatttaaggaaaaatcagcaaaataataggggatgaaag |
3948317 |
T |
|
| Q |
313 |
taaagcaaccaggttcctcatgtaacgtaacttatggccttatgagggttagatg--------taacagagtactgatgctatatatg |
392 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
3948316 |
taaagcaaccaggttcctcaagtaacgtaacttattgccttatgagggtgagatgtaaatatataacagagtactgatgctatatatg |
3948229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 21 - 68
Target Start/End: Complemental strand, 3948962 - 3948915
Alignment:
| Q |
21 |
atggtccaagcccactattaccaagtattgaccttaattaaatttccc |
68 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3948962 |
atggtccaatcccactattaccaagtattgaccttaattaaatttccc |
3948915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 161 - 209
Target Start/End: Complemental strand, 3948738 - 3948690
Alignment:
| Q |
161 |
caaaaaattagaagttagaaaaattatccaatcaaggaaaattgtagct |
209 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
3948738 |
caaaaaattagaagttagaaaaattctccaatcaaagaaaattgtagct |
3948690 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University