View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19556_low_13 (Length: 378)
Name: NF19556_low_13
Description: NF19556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19556_low_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 96; Significance: 5e-47; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 1 - 137
Target Start/End: Complemental strand, 3031277 - 3031139
Alignment:
| Q |
1 |
agtcctcttccagcttagcatattgcagatagagagggttcactcgatcagctggggcctgttttggcaagcattatcc--agagcaaattgtgttagca |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||| ||| | ||||||| ||||||||| |
|
|
| T |
3031277 |
agtcctcttccagcttagcatattgcagatagagaggtttcacttgatcagctggggcctgttttggcaagcattttccaaaaagcaaatagtgttagca |
3031178 |
T |
|
| Q |
99 |
ttataacgcgttatcaacaataaaattcaagtgctacaa |
137 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
3031177 |
ttataatacgttatcaacaataaaattcaagtgttacaa |
3031139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 5 - 65
Target Start/End: Original strand, 12014987 - 12015046
Alignment:
| Q |
5 |
ctcttccagcttagcatattgcagatagagagggttcactcgatcagctggggcctgtttt |
65 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
12014987 |
ctcttccagcttt-catattgtagatagagaggtttcacttgatcagctggggcctgtttt |
12015046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University