View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19556_low_28 (Length: 293)
Name: NF19556_low_28
Description: NF19556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19556_low_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 2 - 278
Target Start/End: Complemental strand, 37392398 - 37392122
Alignment:
| Q |
2 |
aaaactaattggtgggcatgagtataggtcaaatcacttgtttcattggcaagacattagtataataatttaactggacatgcagggagcaagcaagtgg |
101 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37392398 |
aaaactaattggtgggcatgagcataggtcaaatcacttgtttcattggcaagacattagtataataatttaactggacatgcagggagcaagcaagtgg |
37392299 |
T |
 |
| Q |
102 |
ataactgattgtgattaataagtctaattggtggtttaaggctttaagcctttcatttcaccaccggcttgattaaatttgaccctattttctatcacaa |
201 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
37392298 |
ataactgattgtgattaattagtctaattggtggtttaaggctttaagcctttcatttcaccaccggcttgattaaacttgaccctattttctatcacaa |
37392199 |
T |
 |
| Q |
202 |
cttgttgttcatatgtcattcactaccgtttcctttcacatattaagctgtcagtgtgttatatagacttataattg |
278 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37392198 |
cttgttgttcatatgtcattcactaccatttcctttcacatattaagctgtcagtgtgttatatagacttataattg |
37392122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University