View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19556_low_37 (Length: 244)
Name: NF19556_low_37
Description: NF19556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19556_low_37 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 11 - 244
Target Start/End: Original strand, 55381786 - 55382021
Alignment:
| Q |
11 |
cataggtggtggatgggggaaggacgagcgagagagggatgattttcttcgtttttaaatacatatccttaaataataaaatttaaaaacaatccc--ac |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
55381786 |
cataggtggtggatgggggaaggacgagcgagagagggatgattttcttcgtttttaaatacatatccttaaataataaaatttaaaaacaatcccccac |
55381885 |
T |
 |
| Q |
109 |
aatttgttttaaagtcaaagaaatatgtttctaacaacttaataaatcaatgcataaacaattatgtcttttagacgacaaactagcatgagacaaatga |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55381886 |
aatttgttttaaagtcaaagaaatatgtttctaacaacttaataaatcaatgcataaacaattatgtcttttagacgacaaactagcatgagacaaatga |
55381985 |
T |
 |
| Q |
209 |
gctatgatccctaaaaatatcaatgaggttatgacc |
244 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |
|
|
| T |
55381986 |
gctatgatccctaaaaatatcaattaggttatgacc |
55382021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University