View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19556_low_42 (Length: 228)
Name: NF19556_low_42
Description: NF19556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19556_low_42 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 115; Significance: 1e-58; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 85 - 207
Target Start/End: Complemental strand, 1995604 - 1995482
Alignment:
| Q |
85 |
aagtaaaatctcgtaactatatcacttactcaatcggctgagatcgttcaactgtatgactgcgtccttctcatcggtctcgtatcgcggatcaaagtaa |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
1995604 |
aagtaaaatctcgtaactatatcacttactcaatcggctgagatcgttcaactgtgtgactgcgtccttctcataggtctcgtatcgcggatcaaagtaa |
1995505 |
T |
|
| Q |
185 |
acacaaaattattttccttacca |
207 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
1995504 |
acacaaaattattttccttacca |
1995482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 17 - 102
Target Start/End: Complemental strand, 1995703 - 1995618
Alignment:
| Q |
17 |
aaaaagcacaaatattcagaaatctaaccttaataaaatagtcaatataaatcaaatccaaacttgtcaagtaaaatctcgtaact |
102 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1995703 |
aaaatgcacaaatattcagaaatctaacgttaataaaatagtcaatataaatcaaatccaaacttgtcaagtaaaatctcgtaact |
1995618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University