View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19556_low_7 (Length: 438)
Name: NF19556_low_7
Description: NF19556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19556_low_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 48; Significance: 3e-18; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 378 - 425
Target Start/End: Original strand, 34725216 - 34725263
Alignment:
| Q |
378 |
gttttacataaattatcaacacatgttctctttttaataagacactag |
425 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34725216 |
gttttacataaattatcaacacatgttctctttttaataagacactag |
34725263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 42 - 94
Target Start/End: Complemental strand, 26125641 - 26125589
Alignment:
| Q |
42 |
ccttcaattttaaaaaagtttgtcaaggatatggtaagttaaaaagaaccacc |
94 |
Q |
| |
|
||||||| ||||||||||||| |||||||||||| |||| ||||||||||||| |
|
|
| T |
26125641 |
ccttcaactttaaaaaagtttatcaaggatatggcaagtaaaaaagaaccacc |
26125589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University