View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19558_high_12 (Length: 222)
Name: NF19558_high_12
Description: NF19558
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19558_high_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 11 - 205
Target Start/End: Original strand, 17586581 - 17586775
Alignment:
| Q |
11 |
agaatatggagagagagggatgaagaagaagaagaaagccaaagcaaaagcctgagtcgtctggggaccgtattggagatgtgggatagaccactacgag |
110 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
17586581 |
agaaaatggagagagagggatgaagaagaagaagaaagccaaataaaaagcctgagtcgtctggggaccgtattggagacgtgggatagaccactacgag |
17586680 |
T |
 |
| Q |
111 |
ggtaaagatcgcaaatagaggaattccgaaaccggaccatcggatctgagatggggaaagactcgatcgggcaagggcatcatacaagtccttgg |
205 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| || | ||||||||||||||||||||| ||||||| |
|
|
| T |
17586681 |
ggtaaagatcgcaaatagaagaattccgaaaccggaccatcggatctgagatggggaaattcttgctcgggcaagggcatcatacaactccttgg |
17586775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University