View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19558_low_10 (Length: 234)
Name: NF19558_low_10
Description: NF19558
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19558_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 15 - 216
Target Start/End: Original strand, 39094401 - 39094602
Alignment:
| Q |
15 |
aaggagaaatagggatgtctctaagcactattgaactgaattatttagttagttttaagtaaactcatcaaatcaaattagttagtttggagaagttgct |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39094401 |
aaggagaaatagggatgtctctaagcactattgaattgaattatttagttagttttaagtaaactcatcaaatcaaattagttagtttggagaagttgct |
39094500 |
T |
 |
| Q |
115 |
tgctatgcaaggaactaatcaaacgagttagttagaaaatgtaattgtgctatgtaaagcccattatcatgatgtataaatactttgaatgcaaggacta |
214 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39094501 |
tgctatgcaaggaactaatcaaacgaattagttagaaaatgtaattgtgctatgtaaagcccattatcatgatgtataaatactttgaatgcaaggacta |
39094600 |
T |
 |
| Q |
215 |
ac |
216 |
Q |
| |
|
|| |
|
|
| T |
39094601 |
ac |
39094602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University