View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19558_low_11 (Length: 232)
Name: NF19558_low_11
Description: NF19558
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19558_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 117; Significance: 9e-60; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 88 - 216
Target Start/End: Complemental strand, 37493521 - 37493393
Alignment:
| Q |
88 |
acaatttcaaaagaactataaacgattagcatttataaatctccaagaaaagattaaacatgatgtaagtatgcataatattaatgcaacgttattacca |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
37493521 |
acaatttcaaaagaactataaacgattagcatttataaatctccaagaaaagattaaacatgatgtaagcatgcataatattaatgcaacattattacca |
37493422 |
T |
|
| Q |
188 |
tgatgatttatgtgctaggtaggcttcat |
216 |
Q |
| |
|
|||||||||||||| |||||||||||||| |
|
|
| T |
37493421 |
tgatgatttatgtgttaggtaggcttcat |
37493393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 88 - 146
Target Start/End: Complemental strand, 37494996 - 37494938
Alignment:
| Q |
88 |
acaatttcaaaagaactataaacgattagcatttataaatctccaagaaaagattaaac |
146 |
Q |
| |
|
|||| |||||| ||||||| | | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
37494996 |
acaaattcaaaggaactatgatctattagcatttataaatctccaagaaaagattaaac |
37494938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 53 - 86
Target Start/End: Complemental strand, 37493544 - 37493511
Alignment:
| Q |
53 |
ctggttggagcttattataaaaaacaatttcaaa |
86 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
37493544 |
ctggttggagcttattataaaaaacaatttcaaa |
37493511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University