View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19558_low_8 (Length: 270)
Name: NF19558_low_8
Description: NF19558
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19558_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 261
Target Start/End: Original strand, 45975418 - 45975678
Alignment:
| Q |
1 |
ttatgttgcggcaaaacattgctgatgcaatcaaatttacaaatgccatgtggttgcagagatctcaaaatcttttatattgcagttgaagcagcttcag |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
45975418 |
ttatgttgcggcaaaacattgttgatgcaatcaaatttacaaatgccatgtggttgcagagatctcaaaatcttttatattgcagttgaagcagctgcag |
45975517 |
T |
 |
| Q |
101 |
ataacaacttaaaaccatattgcaactagcgttcaataatatttgtgtgattaaatatgccatttttggttatcaggtgagtgggtgcttgtcgtatacg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
45975518 |
ataacaacttaaaaccatattgcaactagcgttcattaatatttgtgtgattaaatatgccatttttggttatcaggtgagtgggtgcttgtcatatacg |
45975617 |
T |
 |
| Q |
201 |
gataagataagtgatggattttacaacatactggggatgaatccgtatctgtggatgatgt |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
45975618 |
gataagataagtgatggattttacaacatactggggatgaatccgtatctgtgggtgatgt |
45975678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University