View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19559_low_7 (Length: 235)
Name: NF19559_low_7
Description: NF19559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19559_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 16 - 217
Target Start/End: Original strand, 53488122 - 53488322
Alignment:
| Q |
16 |
aatactttacatgcagagatttcaaggagtttaatagtaattgaaatagcttatcaccattattggcacaatttgtggatagaaaccgattcaactttgg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
53488122 |
aatactttacatgcagagatttcaaggagtttaatagtgattgaaatagcttatcaccatcattggcacaatt-gtggatagaaaccgattcaactttgg |
53488220 |
T |
|
| Q |
116 |
tggtgcatgcttttaagaatgctgctaaaattccttggttttactaatttgagtagttgttaaaatgcttccaatatttttgaacataataataactcaa |
215 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53488221 |
tgatgcatgcttttaagaatgctgctaaaattccttggttttattaatttgagtagttgttaaaatgcttccaatatttttgaacataataataactcaa |
53488320 |
T |
|
| Q |
216 |
at |
217 |
Q |
| |
|
|| |
|
|
| T |
53488321 |
at |
53488322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University