View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19559_low_9 (Length: 224)
Name: NF19559_low_9
Description: NF19559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19559_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 70 - 208
Target Start/End: Original strand, 32631597 - 32631735
Alignment:
| Q |
70 |
gttgtcacaaaatggttgttgaaacaacatttttctatttataattgtaaaacagaataagtaagggcagtagcacctttcaaaaatgagtgcaaaggga |
169 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32631597 |
gttgtcacaaaatggttgttcaaacatcatttttctatttataattgtaaaacagaataagtaagggcagtagcacctttcaaaaatgagtgcaaaggga |
32631696 |
T |
 |
| Q |
170 |
gcaagggcaattgcagcaatgacattacgataaacaatg |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32631697 |
gcaagggcaattgcagcaatgacattacgataaacaatg |
32631735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University