View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1955_high_5 (Length: 357)
Name: NF1955_high_5
Description: NF1955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1955_high_5 |
 |  |
|
| [»] scaffold0775 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0775 (Bit Score: 131; Significance: 7e-68; HSPs: 2)
Name: scaffold0775
Description:
Target: scaffold0775; HSP #1
Raw Score: 131; E-Value: 7e-68
Query Start/End: Original strand, 38 - 187
Target Start/End: Complemental strand, 502 - 350
Alignment:
| Q |
38 |
gagcagagagcaattgtatcaggccttgcgcgatgttagggagaggttggcacccgttttgaccggaaggcagcagcaggactagga---gaagtaggac |
134 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
502 |
gagcacagagcagttgtatcaggccttgcgcgatgttagggagaggttggcacccgttttgaccggaaggcagcagcaggactaggagaagaagtaggac |
403 |
T |
 |
| Q |
135 |
tagttgatgtgtaggacttgtttttagttttaatgttgagacatgagatagac |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
402 |
tagttgatgtgtaggacttgtttttagttttaatgttgagacatgagatagac |
350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0775; HSP #2
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 241 - 291
Target Start/End: Complemental strand, 296 - 246
Alignment:
| Q |
241 |
acgcatgtggtaactttaagagaaaatgtatcggttgaatctaatatttat |
291 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
296 |
acgcatgtggtaactttaagagataatgtatcggttgaatctaatatttat |
246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University