View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1955_high_8 (Length: 251)
Name: NF1955_high_8
Description: NF1955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1955_high_8 |
 |  |
|
| [»] scaffold0027 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0027 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: scaffold0027
Description:
Target: scaffold0027; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 17322 - 17562
Alignment:
| Q |
1 |
gttgtttataagttgaggagtcaaatgatcaggtttacacatggattcacnnnnnnnnnnnnaacaataaaggttgcacatggctgcataagctgaattt |
100 |
Q |
| |
|
|||| |||||||||||| |||||| |||||||||| |||||||||||||| ||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
17322 |
gttgattataagttgagtagtcaagtgatcaggtt-acacatggattcaccacacacacacaaacaataaaggttgcacatggctacataagctaaattt |
17420 |
T |
 |
| Q |
101 |
tctttatcatatgatccccgatccctataaatgaatatgacatcacatgttaatgaatgagtatggtaccaatacaaaataaataaaaattatgtatcaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17421 |
tctttatcatatgatccccgatccctataaatgaatatgacatcacatgttaatgaatgagtatggtaccaatacaaaataaataaaaattatgtatcaa |
17520 |
T |
 |
| Q |
201 |
attaaacttgcttcctacgccctaatgattgaacagaataat |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17521 |
attaaacttgcttcctacgccctaatgattgaacagaataat |
17562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University