View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1955_low_12 (Length: 281)
Name: NF1955_low_12
Description: NF1955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1955_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 160; Significance: 3e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 41 - 233
Target Start/End: Original strand, 30355349 - 30355541
Alignment:
| Q |
41 |
gggaaattaatccctattttataaaaagttagatttgggttgctacattactcttactcacatgctttcaattacccttgaaaaacaaaatccctatatc |
140 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
30355349 |
gggaaattaatcccctttttataaaaagttagatttgggttgctacattactcttactcacatgctttcaattagccttgaaaaacaaaatccctatatc |
30355448 |
T |
 |
| Q |
141 |
tataatttatgttatacatttcctcnnnnnnntaaataatttatgttatacataacgaaaatacatggtggagtactggagtagttttttact |
233 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30355449 |
tataatttatgttatacatttcctcaaaaaaataaataatttatgttatacataacgaaaatacatggtggagtactggagtagttttttact |
30355541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University