View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1955_low_14 (Length: 251)

Name: NF1955_low_14
Description: NF1955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1955_low_14
NF1955_low_14
[»] scaffold0027 (1 HSPs)
scaffold0027 (1-242)||(17322-17562)


Alignment Details
Target: scaffold0027 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: scaffold0027
Description:

Target: scaffold0027; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 17322 - 17562
Alignment:
1 gttgtttataagttgaggagtcaaatgatcaggtttacacatggattcacnnnnnnnnnnnnaacaataaaggttgcacatggctgcataagctgaattt 100  Q
    |||| |||||||||||| |||||| |||||||||| ||||||||||||||            ||||||||||||||||||||||| |||||||| |||||    
17322 gttgattataagttgagtagtcaagtgatcaggtt-acacatggattcaccacacacacacaaacaataaaggttgcacatggctacataagctaaattt 17420  T
101 tctttatcatatgatccccgatccctataaatgaatatgacatcacatgttaatgaatgagtatggtaccaatacaaaataaataaaaattatgtatcaa 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
17421 tctttatcatatgatccccgatccctataaatgaatatgacatcacatgttaatgaatgagtatggtaccaatacaaaataaataaaaattatgtatcaa 17520  T
201 attaaacttgcttcctacgccctaatgattgaacagaataat 242  Q
    ||||||||||||||||||||||||||||||||||||||||||    
17521 attaaacttgcttcctacgccctaatgattgaacagaataat 17562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University