View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19560_low_3 (Length: 272)
Name: NF19560_low_3
Description: NF19560
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19560_low_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 9 - 257
Target Start/End: Complemental strand, 6248981 - 6248737
Alignment:
| Q |
9 |
catcatcatcactatctgattgtgaaattatctcccattcgatgtcgaaaatttgatggtggctaggcctagttgatccggtcatcttaatttgttggtg |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
6248981 |
catcatcatcactatctgattgtgaaattatctcccattcgatgtcgaaaatttgatggtggctaggcctagttgttccggtcatcttagtttgttggtg |
6248882 |
T |
 |
| Q |
109 |
ggaaatcactttgtctttgatgtcgtaggtttgaggtcgatagtgttnnnnnnncgagcaaatataagtctgagtgctatgttgtttgtatctataggtg |
208 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
6248881 |
gaaaatcactttgtctttgatgtcgtaggtttgaggtcgatagtgttaaaaaaacgagcaaatataagtctgagtgctatgttgtttg----tataggtg |
6248786 |
T |
 |
| Q |
209 |
ggtatttataactaagagaactgggnnnnnnnaaccgtaacaaacaaat |
257 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
6248785 |
ggtatttataactaagagaactgggtttttttaaccgtaacaaacaaat |
6248737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University