View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19560_low_4 (Length: 235)
Name: NF19560_low_4
Description: NF19560
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19560_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 19 - 210
Target Start/End: Complemental strand, 30708470 - 30708284
Alignment:
| Q |
19 |
ggatgacgtatcttaattggtgactttcctttgcttgccagctcagctgcttcccacatcattggaaaaactatttctgttgatggaaaattcaatgtaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
30708470 |
ggatgacgtatcttaattggtgactttcctttgcttgccagct-----gcttcccacatcattggacaaactatttctgttgatggaaaattcaatgtaa |
30708376 |
T |
 |
| Q |
119 |
atggatttcagcccagcataaggattaactcaaataaaaacatcatttttattgtcttcgtttacacagcataaaggtattcaccaaatcct |
210 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
30708375 |
atggatttcatcccagcataaggattaactaaaataaaaatatcatttttattgtcttcgtttacacagcacaaaggtattcaccaaatcct |
30708284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University