View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19562_high_7 (Length: 283)
Name: NF19562_high_7
Description: NF19562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19562_high_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 72 - 267
Target Start/End: Original strand, 9037820 - 9038033
Alignment:
| Q |
72 |
caattgctattacatttggatgtcatatatatacctgcagctagtaaaccaccacatgccagatgttgtacaaaaaattattttaaatagaagtttttga |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||| || | |||||| ||| |
|
|
| T |
9037820 |
caattgctattacatttggatgtcatatatatacctgcagctagtaaaccatcacatgccagatgttgtacaaaaaaatattttgaa-acaagtttctga |
9037918 |
T |
|
| Q |
172 |
t-------------------gatttattttgtatgcacatgcagctggtaaaccacaccatgccagatgatgtactcaacaatgtactgaaacaagtttc |
252 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
9037919 |
ttactttgaaaaaatgtgatgatttattttgtatgcacatgcagctggtaaaccataccatgccagatgatgtactcaacaatgtattgaaacaagtttc |
9038018 |
T |
|
| Q |
253 |
aaattactttgatcc |
267 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
9038019 |
aaattactttgatcc |
9038033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 169 - 267
Target Start/End: Original strand, 9029870 - 9029968
Alignment:
| Q |
169 |
tgatgatttattttgtatgcacatgcagctggtaaaccacaccatgccagatgatgtactcaacaatgtactgaaacaagtttcaaattactttgatcc |
267 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
9029870 |
tgatgatttattttgtacgcacctgcagctggtaaaccataccatgccagatgatgtactcaacaatgtattgaaacaagtttcaaattactttgatcc |
9029968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University