View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19562_low_8 (Length: 354)
Name: NF19562_low_8
Description: NF19562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19562_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 306; Significance: 1e-172; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 4 - 337
Target Start/End: Complemental strand, 32521221 - 32520888
Alignment:
| Q |
4 |
atgtcgaagaatatacggtggataaagctcgttttgattttgcatgtattcttgtatcgactccgaatattgaaattgtgaatcagtcagttgaatttat |
103 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32521221 |
atgtcgacgaatgtacggtggataaagctcgttttgattttgcatgtattcttgtatcgactccgaatattgaaattgtgaatcagtcagttgaatttat |
32521122 |
T |
 |
| Q |
104 |
tattgcaggtaacaggttttgtatcaagttagtggaagaatggggttgtaatttgggagaggatgcttttatgacggaagtggaacctgtttctagttcg |
203 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32521121 |
tattgatggtaacaggttttgtatcaagttagtggaagaatggagttgtaatttgggagaggatgcttttatgacggaagtggaacctgtttctagttcg |
32521022 |
T |
 |
| Q |
204 |
gaggagttacatcaattaaaaaatgccaaagatttggatgaggttcaaggggaatgggaattggatgatttggtgaatgatttgcataaggaatggagtg |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32521021 |
gaggagttacatcaattaaaaaatgccaaagatttggatgaggttcaaggggaatgggaattggatgatttggtgaatgatttgcataaggaatggagtg |
32520922 |
T |
 |
| Q |
304 |
caaatgaggtcaagaaaaatgatatggttaattc |
337 |
Q |
| |
|
|| ||||||||||||||||||||| ||||||||| |
|
|
| T |
32520921 |
cacatgaggtcaagaaaaatgatacggttaattc |
32520888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 18 - 303
Target Start/End: Complemental strand, 52348696 - 52348411
Alignment:
| Q |
18 |
acggtggataaagctcgttttgattttgcatgtattcttgtatcgactccgaatattgaaattgtgaatcagtcagttgaatttattattgcaggtaaca |
117 |
Q |
| |
|
||||||||||||||||| | |||||||| | ||||||||||| | || ||||||||||||||||||||||| |||| |||||||||| ||||||| |
|
|
| T |
52348696 |
acggtggataaagctcgcctagattttgctcgaattcttgtatcaattcaaaatattgaaattgtgaatcagtcccttgattttattattgatggtaaca |
52348597 |
T |
 |
| Q |
118 |
ggttttgtatcaagttagtggaagaatggggttgtaatttgggagaggatgcttttatgacggaagtggaacctgtttctagttcggaggagttacatca |
217 |
Q |
| |
|
||||| ||| ||||| ||||| ||| |||| |||||||||||||| ||||||||| | |||||||||||| ||| |||| |||| || || ||| |
|
|
| T |
52348596 |
agttttttattaagttggtggaggaacggggatgtaatttgggagaagatgcttttttatcggaagtggaacttgtatctaacgcggaagaattttttca |
52348497 |
T |
 |
| Q |
218 |
attaaaaaatgccaaagatttggatgaggttcaaggggaatgggaattggatgatttggtgaatgatttgcataaggaatggagtg |
303 |
Q |
| |
|
| |||||||| || |||||||||||||||||||||||||||||||||||||| ||| || ||||||||||||||||||| |
|
|
| T |
52348496 |
acaaaaaaatgatgtggaattggatgaggttcaaggggaatgggaattggatgatttagtgtcggacttgcataaggaatggagtg |
52348411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 238 - 289
Target Start/End: Complemental strand, 12964751 - 12964700
Alignment:
| Q |
238 |
tggatgaggttcaaggggaatgggaattggatgatttggtgaatgatttgca |
289 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| | | || ||||||||||| |
|
|
| T |
12964751 |
tggatgaggttcaaggtgaatgggaattggatgctctagttaatgatttgca |
12964700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 238 - 302
Target Start/End: Original strand, 2890913 - 2890977
Alignment:
| Q |
238 |
tggatgaggttcaaggggaatgggaattggatgatttggtgaatgatttgcataaggaatggagt |
302 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| | || ||||||||||| || ||||||||| |
|
|
| T |
2890913 |
tggatgaggttcaaggggaatgggagttggatgatcttgttaatgatttgcacaaagaatggagt |
2890977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.000000000008; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 236 - 300
Target Start/End: Complemental strand, 48783606 - 48783542
Alignment:
| Q |
236 |
tttggatgaggttcaaggggaatgggaattggatgatttggtgaatgatttgcataaggaatgga |
300 |
Q |
| |
|
|||||| ||||| |||||||| ||||| ||||||||| | |||||||||||||||||||| |||| |
|
|
| T |
48783606 |
tttggaggaggtccaaggggagtgggagttggatgatcttgtgaatgatttgcataaggagtgga |
48783542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 240 - 302
Target Start/End: Original strand, 13059816 - 13059878
Alignment:
| Q |
240 |
gatgaggttcaaggggaatgggaattggatgatttggtgaatgatttgcataaggaatggagt |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | || |||||||||| || ||||||||| |
|
|
| T |
13059816 |
gatgaggttcaaggggaatgggaattggatgaccttgttcatgatttgcaaaatgaatggagt |
13059878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 135 - 187
Target Start/End: Complemental strand, 48783707 - 48783655
Alignment:
| Q |
135 |
gtggaagaatggggttgtaatttgggagaggatgcttttatgacggaagtgga |
187 |
Q |
| |
|
|||||||||||||| ||| ||||||| |||||||||||| |||| |||||||| |
|
|
| T |
48783707 |
gtggaagaatgggggtgtcatttgggggaggatgcttttttgactgaagtgga |
48783655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 129 - 181
Target Start/End: Complemental strand, 21110757 - 21110705
Alignment:
| Q |
129 |
aagttagtggaagaatggggttgtaatttgggagaggatgcttttatgacgga |
181 |
Q |
| |
|
||||| ||||| || ||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
21110757 |
aagttggtggaggagtggggttgtaatttgggggaggatgctttcatgacgga |
21110705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 129 - 173
Target Start/End: Original strand, 21309186 - 21309230
Alignment:
| Q |
129 |
aagttagtggaagaatggggttgtaatttgggagaggatgctttt |
173 |
Q |
| |
|
||||| ||||| |||||||| ||||||||||| |||||||||||| |
|
|
| T |
21309186 |
aagttggtggaggaatgggggtgtaatttgggggaggatgctttt |
21309230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University