View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19563_high_40 (Length: 269)
Name: NF19563_high_40
Description: NF19563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19563_high_40 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 126 - 252
Target Start/End: Complemental strand, 2507553 - 2507427
Alignment:
| Q |
126 |
aaattttgtactgataccaccatatagaactgtatcccaagtgacaagataaatgacagaattcgtcagctactcttttgacatagaatccatgttatgc |
225 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2507553 |
aaattctgtacatataccaccatatagaactgtatcccaagtgacaagataaatgacagaattcgtcagctactcttttgacatagaatccatgttatgc |
2507454 |
T |
 |
| Q |
226 |
aatatactcagtctttgtggctccact |
252 |
Q |
| |
|
||||||||||||||| ||||||||||| |
|
|
| T |
2507453 |
aatatactcagtcttcgtggctccact |
2507427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University