View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19563_high_51 (Length: 247)

Name: NF19563_high_51
Description: NF19563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19563_high_51
NF19563_high_51
[»] chr4 (1 HSPs)
chr4 (14-232)||(4673132-4673350)


Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 14 - 232
Target Start/End: Complemental strand, 4673350 - 4673132
Alignment:
14 atatctaacaggtactgatcgtccattatggttccccggagcaaagtcaccggagtggctagacggaagtttggtcggagattacggatttgatccattt 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4673350 atatctaacaggtactgatcgtccattatggttccccggagcaaagtcaccggagtggctagacggaagtttggtcggagattacggatttgatccattt 4673251  T
114 ggtttggggaaaccagcagaatatttgcaatttgatctcgactcgcttgatcagaatttggcaaagaatcttgctggagatgtgatcggaaccaggacgg 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4673250 ggtttggggaaaccagcagaatatttgcaatttgatctcgactcgcttgatcagaatttggcaaagaatcttgctggagatgtgatcggaaccaggacgg 4673151  T
214 agtttgctgatgtgaaatc 232  Q
    |||||||||||||||||||    
4673150 agtttgctgatgtgaaatc 4673132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University