View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19563_high_62 (Length: 228)
Name: NF19563_high_62
Description: NF19563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19563_high_62 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 24706649 - 24706857
Alignment:
| Q |
1 |
aacaaaaataggggaacgacaaagattcagtgattttaataatgcgaataacataactgatggactgatctttctacaaagttccgaacaaagtcactta |
100 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
24706649 |
aacaaaaataggggaacgacaaagagacagtgattttaataatgcgaataacataacttatggactgatctttctacaaagttccgaacaa-gtcactta |
24706747 |
T |
 |
| Q |
101 |
gttgtaagaccacttttcaaccacgtggtactcggttcgagactgaacatttggaaattttcaaccaagtttattaactgctgtcaaatcactgtctttt |
200 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24706748 |
gttgtaagaccacttttcaaccttgtggtactcggttcgagactgaacatttggaaattttcaaccaagtttattaactgctgtcaaatcactgtctttt |
24706847 |
T |
 |
| Q |
201 |
gtgtggttgc |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
24706848 |
gtgtggttgc |
24706857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University