View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19563_high_63 (Length: 225)
Name: NF19563_high_63
Description: NF19563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19563_high_63 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 61; Significance: 2e-26; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 144 - 208
Target Start/End: Complemental strand, 14600962 - 14600898
Alignment:
| Q |
144 |
gagcgtgtttcatgctcagttgctttttattctctctgcaacaactcaacacaagataatggaat |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
14600962 |
gagcgtgtttcatgctcagttgctttttattctctctgcaacaacccaacacaagataatggaat |
14600898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 18 - 60
Target Start/End: Complemental strand, 14601088 - 14601046
Alignment:
| Q |
18 |
attaattaacttttgaagaaaatttggtaactgattgtgtagc |
60 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14601088 |
attaattaacttttgaagaaaatttggtaactgattgtgtagc |
14601046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University