View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19563_low_30 (Length: 326)

Name: NF19563_low_30
Description: NF19563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19563_low_30
NF19563_low_30
[»] chr8 (1 HSPs)
chr8 (206-321)||(13908226-13908341)


Alignment Details
Target: chr8 (Bit Score: 100; Significance: 2e-49; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 206 - 321
Target Start/End: Original strand, 13908226 - 13908341
Alignment:
206 atttaaattgttttgtaaacggaaaagttattttgatacggttctcattcggtctaacaataattctctctctaatcaaattaactcttgtttttggtgt 305  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||| |||||||||    
13908226 atttaaattgttttgtaaacggaaaagttattttgatacggttctcattcggtttaacaataattctctctctaatcaaattaactattgcttttggtgt 13908325  T
306 agttttagatgatgtc 321  Q
    ||||||| ||||||||    
13908326 agttttatatgatgtc 13908341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University