View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19563_low_47 (Length: 252)
Name: NF19563_low_47
Description: NF19563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19563_low_47 |
 |  |
|
| [»] scaffold0036 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0036 (Bit Score: 219; Significance: 1e-120; HSPs: 2)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 16 - 238
Target Start/End: Original strand, 22323 - 22545
Alignment:
| Q |
16 |
caattgagtcacctagttgtgaaactagtgatagtggtcctgctccaagaccaacaagacccgtagcttttcggcttcttttaaatgtgacatcatttcg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
22323 |
caattgagtcacctagttgtgaaactagtgatagtggtcctgctccaagaccaacaagacccgtagcttttcggcttcttttaaatgtgacatcattttg |
22422 |
T |
 |
| Q |
116 |
atgtccacatccaaaaattgatttaggaaatgtaacatctttttctccaaagttgatggaatcagtacccaaatctccaatggtgtaagatttatcacca |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22423 |
atgtccacatccaaaaattgatttaggaaatgtaacatctttttctccaaagttgatggaatcagtacccaaatctccaatggtgtaagatttatcacca |
22522 |
T |
 |
| Q |
216 |
taagtgtaaaaatactcacactt |
238 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
22523 |
taagtgtaaaaatactcacactt |
22545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 107 - 163
Target Start/End: Original strand, 14376 - 14432
Alignment:
| Q |
107 |
atcatttcgatgtccacatccaaaaattgatttaggaaatgtaacatctttttctcc |
163 |
Q |
| |
|
||||||| || ||||||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
14376 |
atcattttgaagtccacatccaaaaactgattttggaaatgtaacatctttttctcc |
14432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 26 - 73
Target Start/End: Original strand, 26464508 - 26464555
Alignment:
| Q |
26 |
acctagttgtgaaactagtgatagtggtcctgctccaagaccaacaag |
73 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||| ||||||||||| |
|
|
| T |
26464508 |
acctagttgtgaaactagtgaaaatggtcctgctcctagaccaacaag |
26464555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University