View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19563_low_54 (Length: 241)
Name: NF19563_low_54
Description: NF19563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19563_low_54 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 104; Significance: 6e-52; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 55 - 186
Target Start/End: Original strand, 8395025 - 8395156
Alignment:
| Q |
55 |
gttaacaatgttgagtaattgtcactggttacttacgactcacatcctatatatgcaagttaaatttaatatataaatcaaataactcatatatcacctt |
154 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||| ||| |
|
|
| T |
8395025 |
gttaacaatgttgagtaattgtcacttgttacttacgactcacatcctatatatacaagttaaatttaatatataaatgaaataactcatatatcatctt |
8395124 |
T |
 |
| Q |
155 |
tctttatttttagtccttgactatttatctat |
186 |
Q |
| |
|
|||||||||||| || |||| ||||||||||| |
|
|
| T |
8395125 |
tctttatttttaatctttgagtatttatctat |
8395156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 17 - 52
Target Start/End: Original strand, 8394963 - 8394998
Alignment:
| Q |
17 |
ttacttttgcaatttgcaaagattagtggacaatga |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
8394963 |
ttacttttgcaatttgcaaagattagtggacaatga |
8394998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University