View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19563_low_57 (Length: 236)
Name: NF19563_low_57
Description: NF19563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19563_low_57 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 107; Significance: 9e-54; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 103 - 221
Target Start/End: Complemental strand, 7710092 - 7709974
Alignment:
| Q |
103 |
taagggattcaaatctattaccgattaaactaatccattattgctacttgctaatttaacaatatgcattttgttatttatattagggtcatgctaactt |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7710092 |
taagggattcaaatctattaccaattaaactaatccattattgctacttgctaatttaacaatatgcattttgttatttatattagggtcatactaactt |
7709993 |
T |
|
| Q |
203 |
tctaaggacacatgctaag |
221 |
Q |
| |
|
||||| ||||||||||||| |
|
|
| T |
7709992 |
tctaaagacacatgctaag |
7709974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 7710197 - 7710154
Alignment:
| Q |
1 |
ctcattaactggataagctataatagagttgctgcttgtgctta |
44 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7710197 |
ctcattaactggataagctataatagagttgctgcttgtgctta |
7710154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University