View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19563_low_66 (Length: 223)
Name: NF19563_low_66
Description: NF19563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19563_low_66 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 19 - 160
Target Start/End: Original strand, 18329123 - 18329264
Alignment:
| Q |
19 |
aaggttttattggtgagaatgtgttatgaattaggtaggaagagagataatgaaaaaattggaaacgggtttatgactttgtaagagaggtatagtattc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
18329123 |
aaggttttattggtgagaatgtgttatgaattaggtaggaagagagataatgaaaaaattggaaacgggtttatgactttgtaagagaggtacagtattc |
18329222 |
T |
 |
| Q |
119 |
aaaatcttcaactgctaatagagaaaataggttattcaactc |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18329223 |
aaaatcttcaactgctaatagagaaaataggttattcaactc |
18329264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University