View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19564_high_15 (Length: 205)
Name: NF19564_high_15
Description: NF19564
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19564_high_15 |
 |  |
|
| [»] scaffold0085 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 18 - 192
Target Start/End: Complemental strand, 55000360 - 55000186
Alignment:
| Q |
18 |
gtttgcccatatgactttgaatctagctatgaaatcaaattggggataatcattcttttacacctctcatcttttaacaattaattcattgttaaacaaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55000360 |
gtttgcccatatgactttgaatctagctatgaaatcaaattggggataatcgttcttttacacctctcatcttttaacaattaattcattgttaaacaaa |
55000261 |
T |
 |
| Q |
118 |
ctaggaaattcaaccctctttgaattctctactggaaaataactttggatgcatcggctattcaaaattcttctc |
192 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55000260 |
ctaggaaattcaaccctctttgaatcctctactggaaaataactttggatgcatcggctattcaaaattcttctc |
55000186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 59; Significance: 3e-25; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 126 - 192
Target Start/End: Original strand, 45060147 - 45060213
Alignment:
| Q |
126 |
ttcaaccctctttgaattctctactggaaaataactttggatgcatcggctattcaaaattcttctc |
192 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
45060147 |
ttcaaccctctttgaatcctctactggaaaataacttcggatgcatcggctattcaaaattcttctc |
45060213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 126 - 192
Target Start/End: Complemental strand, 45081924 - 45081858
Alignment:
| Q |
126 |
ttcaaccctctttgaattctctactggaaaataactttggatgcatcggctattcaaaattcttctc |
192 |
Q |
| |
|
||||||||||||||||| |||||| | |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45081924 |
ttcaaccctctttgaatcctctaccgaaaaataactttggatgcatcggctattcaaaattcttctc |
45081858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 18 - 75
Target Start/End: Original strand, 45060091 - 45060148
Alignment:
| Q |
18 |
gtttgcccatatgactttgaatctagctatgaaatcaaattggggataatcattcttt |
75 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
45060091 |
gtttgcccacatgactttgaatctagctatgaaatcaaattggggataatcgttcttt |
45060148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 18 - 75
Target Start/End: Complemental strand, 45081980 - 45081923
Alignment:
| Q |
18 |
gtttgcccatatgactttgaatctagctatgaaatcaaattggggataatcattcttt |
75 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
45081980 |
gtttgcccacatgactttgaatctagctatgaaatcaaattgaggataatcgttcttt |
45081923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 164 - 192
Target Start/End: Original strand, 14592 - 14620
Alignment:
| Q |
164 |
ggatgcatcggctattcaaaattcttctc |
192 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
14592 |
ggatgcatcggctattcaaaattcttctc |
14620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University